Incidental Mutation 'R1931:Ddx23'
ID215401
Institutional Source Beutler Lab
Gene Symbol Ddx23
Ensembl Gene ENSMUSG00000003360
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Synonyms
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location98645134-98662894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98650718 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 370 (R370W)
Ref Sequence ENSEMBL: ENSMUSP00000003450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003450]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003450
AA Change: R370W

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003450
Gene: ENSMUSG00000003360
AA Change: R370W

DomainStartEndE-ValueType
coiled coil region 63 93 N/A INTRINSIC
low complexity region 110 130 N/A INTRINSIC
low complexity region 143 159 N/A INTRINSIC
coiled coil region 161 200 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
coiled coil region 320 352 N/A INTRINSIC
DEXDc 409 641 2.95e-65 SMART
HELICc 677 758 2.43e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161030
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the U5 snRNP complex; it may facilitate conformational changes in the spliceosome during nuclear pre-mRNA splicing. An alternatively spliced transcript variant has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Ddx23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01106:Ddx23 APN 15 98650940 missense probably benign 0.02
IGL02320:Ddx23 APN 15 98650938 missense possibly damaging 0.68
IGL02325:Ddx23 APN 15 98647193 missense possibly damaging 0.80
IGL02456:Ddx23 APN 15 98647549 missense probably damaging 1.00
IGL02514:Ddx23 APN 15 98658318 missense unknown
IGL03173:Ddx23 APN 15 98651004 missense probably benign 0.31
BB007:Ddx23 UTSW 15 98648623 missense probably damaging 1.00
BB017:Ddx23 UTSW 15 98648623 missense probably damaging 1.00
R0077:Ddx23 UTSW 15 98656600 critical splice donor site probably null
R1930:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R1932:Ddx23 UTSW 15 98650718 missense possibly damaging 0.93
R3546:Ddx23 UTSW 15 98650732 missense probably damaging 0.99
R4174:Ddx23 UTSW 15 98658251 missense unknown
R4574:Ddx23 UTSW 15 98647624 missense probably damaging 1.00
R4728:Ddx23 UTSW 15 98650225 missense probably damaging 1.00
R4774:Ddx23 UTSW 15 98647235 missense probably benign 0.00
R4811:Ddx23 UTSW 15 98647471 splice site probably null
R5134:Ddx23 UTSW 15 98650770 missense possibly damaging 0.48
R5895:Ddx23 UTSW 15 98651951 missense probably benign 0.00
R5952:Ddx23 UTSW 15 98658240 missense unknown
R6012:Ddx23 UTSW 15 98650770 missense possibly damaging 0.48
R6289:Ddx23 UTSW 15 98649884 missense probably benign 0.05
R6705:Ddx23 UTSW 15 98652968 nonsense probably null
R7289:Ddx23 UTSW 15 98648611 missense probably damaging 0.98
R7484:Ddx23 UTSW 15 98648689 missense probably damaging 0.99
R7543:Ddx23 UTSW 15 98658258 missense unknown
R7740:Ddx23 UTSW 15 98658434 start codon destroyed probably null
R7930:Ddx23 UTSW 15 98648623 missense probably damaging 1.00
R8084:Ddx23 UTSW 15 98658264 missense unknown
Z1088:Ddx23 UTSW 15 98647621 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGGAACAGAGCTCTCCAGTC -3'
(R):5'- GAGCAGTCACGTTTCTATGGAG -3'

Sequencing Primer
(F):5'- CTACATTTGCAGTCCTAGAACGTAG -3'
(R):5'- CAGTCACGTTTCTATGGAGACCTG -3'
Posted On2014-07-14