Incidental Mutation 'R1931:Tiam2'
ID215405
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3514725 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1413 (R1413C)
Ref Sequence ENSEMBL: ENSMUSP00000125842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041003] [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405]
Predicted Effect probably benign
Transcript: ENSMUST00000041003
SMART Domains Protein: ENSMUSP00000035291
Gene: ENSMUSG00000036983

DomainStartEndE-ValueType
rADc 43 234 5.56e-69 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072156
AA Change: R1413C

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: R1413C

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169838
AA Change: R1413C

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: R1413C

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226997
Predicted Effect probably benign
Transcript: ENSMUST00000227405
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7989:Tiam2 UTSW 17 3518249 nonsense probably null
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
R8221:Tiam2 UTSW 17 3518585 missense probably damaging 0.99
R8260:Tiam2 UTSW 17 3518319 missense possibly damaging 0.94
R8292:Tiam2 UTSW 17 3506867 missense probably benign 0.01
R8406:Tiam2 UTSW 17 3507790 missense possibly damaging 0.94
R8424:Tiam2 UTSW 17 3516041 missense probably damaging 1.00
R8424:Tiam2 UTSW 17 3516042 missense probably damaging 1.00
R8430:Tiam2 UTSW 17 3518262 missense probably benign 0.05
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 splice site probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGGAGGTCTTTGAGAAC -3'
(R):5'- ATGCACATCAAGCCTGGAG -3'

Sequencing Primer
(F):5'- CTTTGAGAACTGGGTGTGTACC -3'
(R):5'- CAGAGGTGTGCTCTCAGTCACTAAG -3'
Posted On2014-07-14