Mutagenetix > Incidental Mutation

Incidental Mutation 'R1931:Lrp5'

215411

Institutional Source

Beutler Lab

Gene Symbol

Lrp5

Ensembl Gene

ENSMUSG00000024913

Gene Name

low density lipoprotein receptor-related protein 5

Synonyms

LR3, LRP7

MMRRC Submission

039949-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.901) question?

Stock #

R1931 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

3584828-3686564 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 3610131 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 978 (V978I)

Ref Sequence

ENSEMBL: ENSMUSP00000025856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025856] [ENSMUST00000177294] [ENSMUST00000177330]

AlphaFold

Q91VN0

Predicted Effect

probably benign
Transcript: ENSMUST00000025856
AA Change: V978I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913
AA Change: V978I

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART
LY	229	270	4e-5	SMART
EGF	297	336	1.01e-1	SMART
LY	364	406	5.15e-8	SMART
LY	407	449	4.12e-16	SMART
LY	450	493	7.68e-16	SMART
LY	494	536	6.24e-16	SMART
LY	537	577	3.73e-5	SMART
EGF	603	640	2.48e-1	SMART
LY	666	708	5.92e-8	SMART
LY	709	751	5.65e-14	SMART
LY	752	795	3.81e-11	SMART
LY	796	837	3.54e-6	SMART
LY	838	877	1.33e-1	SMART
EGF	904	941	1.22e0	SMART
LY	968	1009	4.39e-2	SMART
LY	1015	1057	1.81e0	SMART
LY	1058	1102	9.47e-7	SMART
LY	1103	1145	6.91e-9	SMART
LY	1146	1186	1.53e0	SMART
EGF	1215	1253	2.85e-1	SMART
LDLa	1257	1296	1.23e-13	SMART
LDLa	1297	1333	3.26e-9	SMART
LDLa	1334	1371	1.31e-13	SMART
transmembrane domain	1384	1406	N/A	INTRINSIC
low complexity region	1494	1503	N/A	INTRINSIC
low complexity region	1571	1578	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177294

SMART Domains

Protein: ENSMUSP00000134771
Gene: ENSMUSG00000024913

Domain	Start	End	E-Value	Type
LY	1	26	1.88e1	SMART
LY	27	70	3.81e-11	SMART
LY	71	112	3.54e-6	SMART
LY	113	152	1.33e-1	SMART
EGF	179	216	1.22e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177330

SMART Domains

Protein: ENSMUSP00000134983
Gene: ENSMUSG00000024913

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
LY	54	96	1.26e0	SMART
LY	99	141	2.11e-13	SMART
LY	142	185	1.32e-14	SMART
LY	186	228	1.6e-13	SMART

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
Aak1	T	G	6: 86,956,336	S430A	unknown	Het
Abhd16a	T	A	17: 35,101,015	F337L	probably benign	Het
Acsl1	C	A	8: 46,530,986	A514E	probably benign	Het
Adam29	T	C	8: 55,873,089	Y110C	probably damaging	Het
Adamts12	C	A	15: 11,270,599	Q647K	probably benign	Het
Adamts20	T	A	15: 94,404,010	H27L	probably benign	Het
Adamtsl1	A	G	4: 86,342,411	E961G	possibly damaging	Het
AU022751	T	C	X: 6,082,763	E66G	probably benign	Het
AW011738	T	C	4: 156,203,540		probably benign	Het
Bcl9	T	C	3: 97,205,144	M1332V	probably damaging	Het
Birc6	T	C	17: 74,565,982	I412T	probably damaging	Het
Cav1	A	T	6: 17,339,332	I139F	probably damaging	Het
Col4a4	A	C	1: 82,466,600		probably null	Het
Coro2a	A	T	4: 46,539,138	*544R	probably null	Het
Cox15	C	T	19: 43,746,785	R181H	probably benign	Het
Ddx23	G	A	15: 98,650,718	R370W	possibly damaging	Het
Dennd2c	A	G	3: 103,133,252	N278D	probably benign	Het
Dgkh	T	C	14: 78,616,505	I265V	probably damaging	Het
Diexf	T	A	1: 193,118,309	K401I	probably damaging	Het
Dpp3	A	T	19: 4,917,860		probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Ece1	A	G	4: 137,938,763	K306R	probably benign	Het
Eif4b	T	C	15: 102,088,976	S309P	unknown	Het
Eml3	G	A	19: 8,937,143	V507M	probably benign	Het
Fat1	C	T	8: 45,044,228	T4250M	possibly damaging	Het
Fezf1	T	G	6: 23,246,907	I309L	probably damaging	Het
Fsip2	T	A	2: 82,986,733	L4270H	probably damaging	Het
Gabra4	T	C	5: 71,638,237	K206E	probably damaging	Het
Gfm1	A	G	3: 67,456,585	K465E	probably benign	Het
Gpld1	A	T	13: 24,943,710	I32L	possibly damaging	Het
Hist1h4k	A	T	13: 21,750,512		probably null	Het
Hoxd12	A	G	2: 74,675,513	T143A	probably benign	Het
Hoxd12	A	G	2: 74,675,531	T149A	probably benign	Het
Hspg2	T	A	4: 137,540,230	S2050T	probably damaging	Het
Il31ra	T	A	13: 112,541,222	N287I	probably damaging	Het
Itga4	G	A	2: 79,313,844		probably null	Het
Itpr2	A	G	6: 146,240,354	V1730A	probably benign	Het
Klkb1	T	A	8: 45,275,477	Q415L	probably benign	Het
Lcn10	A	G	2: 25,684,335	Y118C	probably damaging	Het
Lgi3	T	C	14: 70,536,268	V294A	probably damaging	Het
Naaa	A	G	5: 92,278,035	V33A	probably benign	Het
Nckap5l	A	G	15: 99,427,261	F454L	probably damaging	Het
Nol10	A	G	12: 17,348,554	M1V	probably null	Het
Olfm1	G	A	2: 28,222,662		probably null	Het
Olfr520	G	T	7: 99,735,860	R239L	possibly damaging	Het
Olfr784	T	A	10: 129,387,876	M81K	probably benign	Het
Olfr849	T	C	9: 19,441,351	L146P	possibly damaging	Het
Osbp2	T	C	11: 3,726,333		probably null	Het
Osbpl1a	T	A	18: 12,905,194	Q269L	probably benign	Het
Papss2	T	A	19: 32,638,968	C191*	probably null	Het
Pbxip1	A	T	3: 89,447,677		probably null	Het
Pdp1	A	G	4: 11,962,074	I79T	probably benign	Het
Peg10	A	G	6: 4,755,778	Y118C	probably damaging	Het
Pnisr	A	G	4: 21,873,612	T452A	probably benign	Het
Polr2a	A	T	11: 69,735,375	Y1612N	unknown	Het
Polr3c	A	T	3: 96,719,298	L270H	probably damaging	Het
Prr11	A	T	11: 87,106,042	L32*	probably null	Het
Ptgfr	T	A	3: 151,835,194	T226S	probably benign	Het
Ptprz1	T	A	6: 23,007,355	V1639E	probably damaging	Het
Rps6kb1	A	G	11: 86,532,821	V111A	possibly damaging	Het
Sfxn1	A	T	13: 54,093,933	I226F	probably damaging	Het
Sh3pxd2a	A	G	19: 47,267,508	S924P	probably benign	Het
Slc16a5	A	T	11: 115,469,368	I126F	probably damaging	Het
Slc8a3	G	T	12: 81,314,446	T533N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spata3	A	C	1: 86,022,061		probably benign	Het
St8sia6	A	G	2: 13,792,812	S48P	probably benign	Het
Stra6l	A	T	4: 45,882,698	R470*	probably null	Het
Stradb	A	C	1: 58,991,105	N173H	probably benign	Het
Sugp1	T	A	8: 70,071,540	D598E	probably benign	Het
Tekt2	T	C	4: 126,322,817		probably null	Het
Tiam2	C	T	17: 3,514,725	R1413C	possibly damaging	Het
Tmprss2	T	C	16: 97,569,062	S301G	probably benign	Het
Tnrc18	A	T	5: 142,776,324	N515K	unknown	Het
Togaram1	A	G	12: 64,966,935	Y320C	probably damaging	Het
Trim41	A	G	11: 48,807,492	V549A	probably damaging	Het
Ugt2b1	T	A	5: 86,917,841	L446F	probably damaging	Het
Unc5b	T	C	10: 60,772,569	T621A	probably benign	Het
Vmn1r214	C	A	13: 23,035,324	H329Q	possibly damaging	Het
Vmn2r109	T	A	17: 20,553,810	K428*	probably null	Het
Vmn2r81	A	C	10: 79,293,494	I740L	probably damaging	Het
Wdfy3	A	G	5: 101,941,492	L612P	probably damaging	Het
Zfp109	G	A	7: 24,228,736	T424M	probably damaging	Het
Zfp735	A	T	11: 73,711,851	K540N	possibly damaging	Het

Other mutations in Lrp5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Lrp5	APN	19	3649404	missense	probably benign
IGL00902:Lrp5	APN	19	3600774	missense	probably damaging	1.00
IGL02032:Lrp5	APN	19	3615886	splice site	probably benign
IGL02331:Lrp5	APN	19	3591816	missense	possibly damaging	0.64
IGL02401:Lrp5	APN	19	3593585	missense	probably damaging	1.00
IGL02471:Lrp5	APN	19	3602408	missense	probably benign	0.31
IGL02572:Lrp5	APN	19	3614283	missense	probably benign	0.17
IGL02637:Lrp5	APN	19	3630269	missense	probably benign	0.03
IGL02696:Lrp5	APN	19	3602253	missense	probably benign
IGL02742:Lrp5	APN	19	3604022	missense	probably damaging	0.99
IGL02804:Lrp5	APN	19	3600777	missense	possibly damaging	0.63
IGL03089:Lrp5	APN	19	3620314	splice site	probably null
IGL03243:Lrp5	APN	19	3630159	missense	probably benign	0.12
Contrarian	UTSW	19	3659355	missense	probably damaging	1.00
Contrarian2	UTSW	19	3652296	missense	probably damaging	1.00
lucent	UTSW	19	3686353	critical splice donor site	probably null
Microtome	UTSW	19	3622638	missense	probably damaging	1.00
r18	UTSW	19		small insertion
Spicule	UTSW	19	3612197	critical splice donor site	probably null
Stirrup	UTSW	19	3600753	missense	probably damaging	1.00
PIT4494001:Lrp5	UTSW	19	3610091	missense	probably damaging	1.00
R0219:Lrp5	UTSW	19	3597349	missense	probably damaging	1.00
R0526:Lrp5	UTSW	19	3628295	missense	probably damaging	1.00
R0597:Lrp5	UTSW	19	3600777	missense	possibly damaging	0.63
R0883:Lrp5	UTSW	19	3605308	missense	probably damaging	1.00
R1086:Lrp5	UTSW	19	3649476	missense	probably benign	0.28
R1417:Lrp5	UTSW	19	3586425	missense	probably benign	0.04
R1468:Lrp5	UTSW	19	3620191	missense	possibly damaging	0.76
R1468:Lrp5	UTSW	19	3620191	missense	possibly damaging	0.76
R1533:Lrp5	UTSW	19	3614234	missense	probably benign	0.17
R1538:Lrp5	UTSW	19	3647585	missense	possibly damaging	0.70
R1856:Lrp5	UTSW	19	3597346	missense	probably benign	0.18
R1930:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1932:Lrp5	UTSW	19	3610131	missense	probably benign	0.02
R1951:Lrp5	UTSW	19	3620298	missense	possibly damaging	0.89
R2016:Lrp5	UTSW	19	3610056	missense	probably benign	0.04
R2131:Lrp5	UTSW	19	3622708	missense	possibly damaging	0.87
R2153:Lrp5	UTSW	19	3614339	missense	probably benign	0.22
R2403:Lrp5	UTSW	19	3597430	missense	probably damaging	1.00
R3158:Lrp5	UTSW	19	3615849	missense	probably damaging	0.97
R3771:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3772:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3773:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3825:Lrp5	UTSW	19	3605290	nonsense	probably null
R3887:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3888:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3893:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R3917:Lrp5	UTSW	19	3612330	missense	probably damaging	1.00
R4279:Lrp5	UTSW	19	3591778	missense	possibly damaging	0.94
R4714:Lrp5	UTSW	19	3659454	missense	probably damaging	1.00
R4825:Lrp5	UTSW	19	3614292	missense	probably damaging	1.00
R5102:Lrp5	UTSW	19	3659304	missense	probably damaging	0.96
R5138:Lrp5	UTSW	19	3628319	missense	probably benign	0.03
R5497:Lrp5	UTSW	19	3602319	missense	probably damaging	1.00
R5632:Lrp5	UTSW	19	3622512	missense	probably benign
R5887:Lrp5	UTSW	19	3604094	missense	probably benign	0.01
R5950:Lrp5	UTSW	19	3602333	missense	probably benign	0.17
R5987:Lrp5	UTSW	19	3628299	missense	probably damaging	1.00
R6080:Lrp5	UTSW	19	3628316	missense	probably benign	0.32
R6181:Lrp5	UTSW	19	3628427	missense	probably damaging	1.00
R6236:Lrp5	UTSW	19	3630483	splice site	probably null
R6332:Lrp5	UTSW	19	3659355	missense	probably damaging	1.00
R6511:Lrp5	UTSW	19	3652296	missense	probably damaging	1.00
R6641:Lrp5	UTSW	19	3652287	missense	probably damaging	1.00
R6791:Lrp5	UTSW	19	3600753	missense	probably damaging	1.00
R6865:Lrp5	UTSW	19	3620013	critical splice donor site	probably null
R6906:Lrp5	UTSW	19	3622638	missense	probably damaging	1.00
R6922:Lrp5	UTSW	19	3605301	missense	probably damaging	1.00
R7091:Lrp5	UTSW	19	3630184	missense	probably damaging	1.00
R7303:Lrp5	UTSW	19	3591774	missense	probably damaging	0.99
R7368:Lrp5	UTSW	19	3620085	missense	possibly damaging	0.95
R7381:Lrp5	UTSW	19	3593588	missense	probably benign	0.20
R7385:Lrp5	UTSW	19	3612197	critical splice donor site	probably null
R7392:Lrp5	UTSW	19	3610199	missense	probably damaging	1.00
R7448:Lrp5	UTSW	19	3649439	missense	probably benign	0.01
R7585:Lrp5	UTSW	19	3604094	missense	possibly damaging	0.88
R7662:Lrp5	UTSW	19	3686353	critical splice donor site	probably null
R7984:Lrp5	UTSW	19	3612342	missense	probably damaging	1.00
R8056:Lrp5	UTSW	19	3597337	missense	probably damaging	0.98
R8391:Lrp5	UTSW	19	3604185	missense	probably damaging	1.00
R8881:Lrp5	UTSW	19	3591015	missense	probably damaging	0.98
R8885:Lrp5	UTSW	19	3652170	missense	probably damaging	1.00
R9051:Lrp5	UTSW	19	3630156	missense	possibly damaging	0.89
R9263:Lrp5	UTSW	19	3604190	missense	probably damaging	1.00
R9376:Lrp5	UTSW	19	3620286	missense	probably benign	0.00
R9400:Lrp5	UTSW	19	3585272	missense	probably benign	0.00
R9536:Lrp5	UTSW	19	3622672	missense	probably damaging	1.00
R9600:Lrp5	UTSW	19	3591712	missense	probably benign	0.00
Z1177:Lrp5	UTSW	19	3628345	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGAGCCCAAATCCTTGTTTG -3'
(R):5'- TGCTAATGCTCTCTGCTCAG -3'

Sequencing Primer
(F):5'- AAATCCTTGTTTGCCACCAGC -3'
(R):5'- AGTCTGTCTGTCCTGCTCCAG -3'

Posted On

2014-07-14