Incidental Mutation 'R1932:Lct'
ID215425
Institutional Source Beutler Lab
Gene Symbol Lct
Ensembl Gene ENSMUSG00000026354
Gene Namelactase
SynonymsLPH, LOC226413, Lphl
MMRRC Submission 039950-MU
Accession Numbers

Genbank: NM_001081078; MGI:104576

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1932 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location128284756-128328318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128294161 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1547 (A1547E)
Ref Sequence ENSEMBL: ENSMUSP00000073190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073490]
Predicted Effect probably damaging
Transcript: ENSMUST00000073490
AA Change: A1547E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073190
Gene: ENSMUSG00000026354
AA Change: A1547E

DomainStartEndE-ValueType
Pfam:Glyco_hydro_1 76 226 1.6e-19 PFAM
low complexity region 322 340 N/A INTRINSIC
Pfam:Glyco_hydro_1 380 849 4.8e-169 PFAM
low complexity region 865 875 N/A INTRINSIC
Pfam:Glyco_hydro_1 902 1368 3.7e-181 PFAM
Pfam:Glyco_hydro_1 1377 1844 6.9e-183 PFAM
transmembrane domain 1885 1907 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162067
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyl hydrolase 1 family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme is integral to the plasma membrane and has both phlorizin hydrolase activity and lactase activity. Mutations in this gene are associated with congenital lactase deficiency. Polymorphisms in this gene are associated with lactase persistence, in which intestinal lactase activity persists at childhood levels into adulthood. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,279,394 Q278H probably benign Het
Ace3 T C 11: 106,004,610 probably null Het
Aco1 T C 4: 40,176,499 V221A probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamts8 A G 9: 30,956,512 D544G probably benign Het
Angptl4 C A 17: 33,781,275 E40* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip2 T A 16: 10,241,703 I369N possibly damaging Het
Atp6ap1l T A 13: 90,883,687 Y292F probably damaging Het
Atp6v1b2 A T 8: 69,102,807 K217* probably null Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Blvra T A 2: 127,095,148 W174R probably damaging Het
Catsperg1 C T 7: 29,198,143 G239R probably damaging Het
Ccdc157 G T 11: 4,146,549 A400D probably damaging Het
Chd2 G T 7: 73,454,445 P1298T probably damaging Het
CK137956 G A 4: 127,946,858 L352F possibly damaging Het
Col22a1 G A 15: 71,870,140 P503S unknown Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Crem C T 18: 3,299,284 G47R probably benign Het
Crygs T A 16: 22,806,554 T46S probably benign Het
Cts8 T A 13: 61,253,615 H62L probably damaging Het
Cyp4a32 T A 4: 115,611,277 F319I possibly damaging Het
Dchs1 T C 7: 105,765,902 S692G probably damaging Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Defa29 A T 8: 21,326,849 S43T probably damaging Het
Dnajc14 A G 10: 128,816,792 D573G probably damaging Het
Drd5 A G 5: 38,319,976 Y104C probably benign Het
Efcab7 C T 4: 99,911,018 P102L probably damaging Het
Efhc1 A G 1: 20,967,400 Y267C probably damaging Het
Eif2ak4 T C 2: 118,448,486 Y243H probably damaging Het
Gfm2 T A 13: 97,141,967 I7N probably damaging Het
Gmds A G 13: 32,127,997 F150L possibly damaging Het
Gp2 T C 7: 119,454,232 T169A possibly damaging Het
Grb14 A G 2: 64,912,802 F508L probably damaging Het
Hdac5 T A 11: 102,195,872 probably benign Het
Heatr1 T A 13: 12,435,185 M620K probably damaging Het
Herc3 A G 6: 58,876,793 E608G probably damaging Het
Hoxb4 T C 11: 96,320,041 Y156H probably damaging Het
Ifi205 T A 1: 174,028,414 I17F possibly damaging Het
Il2rb A T 15: 78,491,777 S25T possibly damaging Het
Kansl1 T C 11: 104,335,097 T998A probably damaging Het
Kcna6 G T 6: 126,738,488 H479Q probably benign Het
Kif2a T C 13: 106,978,091 K350R probably benign Het
Lhx9 T A 1: 138,842,009 probably benign Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Lrp4 G A 2: 91,497,355 W1516* probably null Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Ltbp1 T A 17: 75,313,034 D719E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Macf1 A G 4: 123,452,037 I1326T probably damaging Het
Manba T C 3: 135,544,740 F376S probably benign Het
Mink1 T C 11: 70,608,428 probably null Het
Nfatc2ip C T 7: 126,384,992 V410I probably damaging Het
Nlrp1b A T 11: 71,182,138 I293N probably damaging Het
Olfr432 T C 1: 174,050,678 Y102H probably damaging Het
Otol1 A C 3: 70,028,104 E476D probably benign Het
Pcdhb4 C T 18: 37,309,541 P635S probably benign Het
Pfkfb4 T A 9: 108,999,169 F91I probably damaging Het
Polq G A 16: 37,062,304 R1610Q possibly damaging Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Ppp1r15b C T 1: 133,131,625 probably benign Het
Prkca T G 11: 108,192,149 D90A probably benign Het
Sall3 T C 18: 80,969,753 D1156G probably benign Het
Scn7a A T 2: 66,676,102 L1481H probably damaging Het
Selenon A T 4: 134,544,618 I292N probably damaging Het
Sema6d T A 2: 124,659,886 probably null Het
Sgpp1 G T 12: 75,716,179 Y409* probably null Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc25a13 A G 6: 6,042,264 V638A probably benign Het
Snhg11 T C 2: 158,376,826 probably benign Het
Sorbs2 A G 8: 45,796,352 Q800R probably benign Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Swap70 C T 7: 110,279,263 A480V possibly damaging Het
Sycp2 A G 2: 178,381,957 V422A probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet3 T C 6: 83,404,379 N269S possibly damaging Het
Thap12 A T 7: 98,716,838 I738F possibly damaging Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmem229a A T 6: 24,955,011 F248Y probably damaging Het
Tmprss7 G A 16: 45,684,593 Q145* probably null Het
Tnc A T 4: 63,993,025 probably null Het
Tonsl A T 15: 76,624,597 Y21N probably damaging Het
Tpr A G 1: 150,421,663 D1009G probably benign Het
Trpm2 G A 10: 77,941,158 A435V probably damaging Het
Ubr3 T A 2: 69,953,476 probably null Het
Vcan T C 13: 89,705,534 N436D possibly damaging Het
Vmn2r104 T A 17: 20,040,769 Y464F probably damaging Het
Vmn2r44 T A 7: 8,367,982 R688S probably benign Het
Wdr74 G T 19: 8,737,947 V157L probably benign Het
Wnt7a T A 6: 91,394,548 D144V probably benign Het
Zfp106 C T 2: 120,531,681 A986T possibly damaging Het
Other mutations in Lct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Lct APN 1 128287556 missense probably benign 0.09
IGL00970:Lct APN 1 128304068 missense probably damaging 1.00
IGL01022:Lct APN 1 128300859 missense probably benign
IGL01878:Lct APN 1 128294266 missense probably damaging 1.00
IGL01892:Lct APN 1 128307605 missense probably damaging 1.00
IGL02307:Lct APN 1 128286590 missense possibly damaging 0.70
IGL02434:Lct APN 1 128303790 missense probably damaging 0.97
IGL02559:Lct APN 1 128294266 missense probably damaging 1.00
IGL02623:Lct APN 1 128308251 missense probably benign 0.01
IGL02818:Lct APN 1 128300168 missense probably damaging 1.00
IGL02949:Lct APN 1 128313132 missense probably benign 0.26
IGL02951:Lct APN 1 128300211 missense probably damaging 1.00
IGL03087:Lct APN 1 128300375 missense possibly damaging 0.81
IGL03227:Lct APN 1 128327689 missense probably benign 0.09
ANU18:Lct UTSW 1 128308047 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0071:Lct UTSW 1 128292018 nonsense probably null
R0135:Lct UTSW 1 128285123 missense probably damaging 0.98
R0145:Lct UTSW 1 128327895 missense probably benign 0.00
R0179:Lct UTSW 1 128327685 missense probably benign
R0331:Lct UTSW 1 128298742 splice site probably benign
R0366:Lct UTSW 1 128286462 missense probably benign 0.03
R0399:Lct UTSW 1 128300525 missense probably damaging 1.00
R0492:Lct UTSW 1 128300582 missense probably damaging 1.00
R0548:Lct UTSW 1 128285195 missense probably damaging 1.00
R0691:Lct UTSW 1 128308234 missense probably benign 0.00
R0755:Lct UTSW 1 128294135 missense possibly damaging 0.46
R0839:Lct UTSW 1 128286609 missense probably benign 0.00
R1128:Lct UTSW 1 128301309 missense probably damaging 0.99
R1135:Lct UTSW 1 128294124 critical splice donor site probably null
R1321:Lct UTSW 1 128300022 missense probably benign
R1448:Lct UTSW 1 128307822 missense probably damaging 0.99
R1450:Lct UTSW 1 128307903 missense probably damaging 1.00
R1572:Lct UTSW 1 128294195 missense probably benign 0.25
R1582:Lct UTSW 1 128300562 missense probably damaging 1.00
R1668:Lct UTSW 1 128287722 splice site probably null
R1757:Lct UTSW 1 128301257 missense probably damaging 1.00
R1775:Lct UTSW 1 128300301 missense probably damaging 1.00
R1792:Lct UTSW 1 128327942 missense possibly damaging 0.54
R1815:Lct UTSW 1 128300159 missense probably damaging 1.00
R2325:Lct UTSW 1 128304226 missense probably damaging 1.00
R2381:Lct UTSW 1 128304121 nonsense probably null
R3001:Lct UTSW 1 128304226 missense probably damaging 1.00
R3002:Lct UTSW 1 128304226 missense probably damaging 1.00
R3003:Lct UTSW 1 128304226 missense probably damaging 1.00
R3011:Lct UTSW 1 128301372 missense possibly damaging 0.74
R3082:Lct UTSW 1 128287608 missense probably damaging 1.00
R3683:Lct UTSW 1 128304226 missense probably damaging 1.00
R3684:Lct UTSW 1 128304226 missense probably damaging 1.00
R3726:Lct UTSW 1 128304226 missense probably damaging 1.00
R3886:Lct UTSW 1 128304226 missense probably damaging 1.00
R3887:Lct UTSW 1 128304226 missense probably damaging 1.00
R3888:Lct UTSW 1 128304226 missense probably damaging 1.00
R4019:Lct UTSW 1 128304226 missense probably damaging 1.00
R4027:Lct UTSW 1 128285181 missense probably benign 0.00
R4226:Lct UTSW 1 128304226 missense probably damaging 1.00
R4409:Lct UTSW 1 128304226 missense probably damaging 1.00
R4514:Lct UTSW 1 128300514 missense probably benign
R4570:Lct UTSW 1 128299904 missense probably benign 0.01
R4776:Lct UTSW 1 128300387 missense probably damaging 0.99
R5001:Lct UTSW 1 128308241 missense probably damaging 0.96
R5021:Lct UTSW 1 128300565 missense probably benign 0.38
R5318:Lct UTSW 1 128304372 missense probably damaging 1.00
R5330:Lct UTSW 1 128298529 missense probably benign 0.06
R5385:Lct UTSW 1 128311617 missense possibly damaging 0.63
R5499:Lct UTSW 1 128286677 missense probably damaging 1.00
R5508:Lct UTSW 1 128294131 missense probably damaging 1.00
R5642:Lct UTSW 1 128295232 missense probably damaging 1.00
R5724:Lct UTSW 1 128300336 missense probably benign
R6026:Lct UTSW 1 128300018 missense probably benign
R6044:Lct UTSW 1 128307980 missense possibly damaging 0.95
R6175:Lct UTSW 1 128327714 missense probably damaging 1.00
R6277:Lct UTSW 1 128304237 missense probably benign 0.01
R6412:Lct UTSW 1 128327718 missense probably benign 0.00
R6480:Lct UTSW 1 128294320 missense probably damaging 1.00
R6526:Lct UTSW 1 128300478 missense probably benign 0.05
R6620:Lct UTSW 1 128295072 critical splice donor site probably null
R7214:Lct UTSW 1 128300460 missense probably benign 0.00
R7308:Lct UTSW 1 128319087 missense probably benign 0.00
X0052:Lct UTSW 1 128307630 missense probably damaging 1.00
YA93:Lct UTSW 1 128301320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTAGTCAGCCTGTTGTGTC -3'
(R):5'- GCTCTGACTTGCTCATAGGTG -3'

Sequencing Primer
(F):5'- TCTTTCTCAGGAGAGCAGGCAG -3'
(R):5'- CTCATAGGTGACCATGTATCACTGG -3'
Posted On2014-07-14