Incidental Mutation 'R0129:Kcnh7'
ID 21543
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Name potassium voltage-gated channel, subfamily H (eag-related), member 7
Synonyms erg3, 9330137I11Rik, Kv11.3
MMRRC Submission 038414-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.101) question?
Stock # R0129 (G1)
Quality Score 148
Status Validated (trace)
Chromosome 2
Chromosomal Location 62524428-63014980 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 62546503 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1026 (T1026I)
Ref Sequence ENSEMBL: ENSMUSP00000074563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052]
AlphaFold Q9ER47
Predicted Effect probably benign
Transcript: ENSMUST00000075052
AA Change: T1026I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: T1026I

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Meta Mutation Damage Score 0.1068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,920,265 (GRCm39) D31G probably damaging Het
Actr2 A G 11: 20,050,939 (GRCm39) probably benign Het
Adcy8 A G 15: 64,618,862 (GRCm39) C764R probably benign Het
Ago4 A C 4: 126,410,976 (GRCm39) F171C possibly damaging Het
Akt2 T C 7: 27,336,395 (GRCm39) F408S probably damaging Het
Ankrd24 T C 10: 81,474,163 (GRCm39) L26P probably damaging Het
Appl1 A T 14: 26,650,600 (GRCm39) M524K probably damaging Het
Arhgef11 T A 3: 87,635,370 (GRCm39) I922N probably damaging Het
Atp5pd T C 11: 115,308,744 (GRCm39) E47G probably damaging Het
Birc6 A G 17: 74,835,755 (GRCm39) D70G probably benign Het
Bola2 G A 7: 126,295,731 (GRCm39) V56M probably damaging Het
Cd300lg A G 11: 101,944,918 (GRCm39) probably null Het
Cdc42bpb A G 12: 111,271,393 (GRCm39) probably benign Het
Ceacam20 A G 7: 19,710,185 (GRCm39) N403S probably damaging Het
Cenpf T C 1: 189,391,847 (GRCm39) M662V probably benign Het
Chd3 C A 11: 69,239,327 (GRCm39) E1607* probably null Het
Chtf18 A T 17: 25,946,285 (GRCm39) Y9* probably null Het
Clta A G 4: 44,032,424 (GRCm39) N200S probably benign Het
Csmd1 G A 8: 16,129,956 (GRCm39) S1722F possibly damaging Het
Cyria C T 12: 12,412,350 (GRCm39) T204I probably damaging Het
Dennd4a T C 9: 64,800,576 (GRCm39) S905P probably damaging Het
Dhx57 T C 17: 80,546,343 (GRCm39) K1347R probably damaging Het
Dmc1 A T 15: 79,480,441 (GRCm39) probably benign Het
Dnhd1 G T 7: 105,370,131 (GRCm39) A4519S probably benign Het
Dnmbp A G 19: 43,838,466 (GRCm39) C1120R probably benign Het
Efs C T 14: 55,154,680 (GRCm39) A427T probably damaging Het
Erich6 T C 3: 58,531,799 (GRCm39) E399G probably damaging Het
Espl1 A G 15: 102,225,083 (GRCm39) T1431A probably benign Het
Fam184b A G 5: 45,690,120 (GRCm39) S830P probably damaging Het
Herc1 T A 9: 66,355,357 (GRCm39) C2203S probably damaging Het
Itpr1 G A 6: 108,326,637 (GRCm39) V120M probably damaging Het
Kif1b A G 4: 149,345,658 (GRCm39) I394T probably benign Het
Ldlrap1 A C 4: 134,484,733 (GRCm39) V87G probably damaging Het
Lgals12 C T 19: 7,580,403 (GRCm39) V155I probably damaging Het
Limch1 A T 5: 67,116,933 (GRCm39) N116I probably damaging Het
Lonp2 C T 8: 87,361,518 (GRCm39) R232C probably damaging Het
Lrch1 C A 14: 75,073,186 (GRCm39) C151F probably benign Het
Lrig3 A G 10: 125,842,812 (GRCm39) Y579C probably damaging Het
Macf1 T C 4: 123,327,068 (GRCm39) S4808G probably damaging Het
Mapkap1 A T 2: 34,513,494 (GRCm39) K501N probably damaging Het
Mdc1 G T 17: 36,165,337 (GRCm39) R1523L probably benign Het
Mlh3 C T 12: 85,312,914 (GRCm39) probably benign Het
Mul1 T C 4: 138,165,032 (GRCm39) probably benign Het
Mybl2 G A 2: 162,901,411 (GRCm39) probably benign Het
Notch1 G C 2: 26,350,470 (GRCm39) H2223Q probably benign Het
Notch2 C A 3: 98,053,936 (GRCm39) L2200M probably benign Het
Odad3 G T 9: 21,904,848 (GRCm39) R313S probably damaging Het
Or10ak8 A T 4: 118,774,667 (GRCm39) probably null Het
Or12k5 G A 2: 36,895,057 (GRCm39) R190* probably null Het
Or5ae2 T A 7: 84,506,196 (GRCm39) F206L probably benign Het
Or8a1b T C 9: 37,623,236 (GRCm39) Y113C probably damaging Het
Plekhs1 T C 19: 56,465,722 (GRCm39) probably null Het
Ppm1h G A 10: 122,777,260 (GRCm39) G509R probably damaging Het
Ppp2r3c C T 12: 55,345,207 (GRCm39) E94K probably damaging Het
Ppp2r5e T A 12: 75,509,164 (GRCm39) I372F probably damaging Het
Ptprt G A 2: 162,119,990 (GRCm39) T159I probably benign Het
Rab20 A G 8: 11,504,415 (GRCm39) F95S probably damaging Het
Rfc3 A C 5: 151,574,616 (GRCm39) M1R probably null Het
Skp2 A G 15: 9,125,280 (GRCm39) S100P probably damaging Het
Smg5 T C 3: 88,256,540 (GRCm39) S269P probably benign Het
Sspo A T 6: 48,432,352 (GRCm39) T684S probably benign Het
Syt3 A G 7: 44,042,782 (GRCm39) K355E probably damaging Het
Tcp10a A T 17: 7,610,903 (GRCm39) K355N probably damaging Het
Tnrc18 A G 5: 142,750,800 (GRCm39) probably benign Het
Tsfm A G 10: 126,866,339 (GRCm39) L74P probably benign Het
Ttn G C 2: 76,564,609 (GRCm39) N28509K probably damaging Het
Ube2l6 G A 2: 84,629,252 (GRCm39) M1I probably null Het
Vmn2r80 T A 10: 79,005,330 (GRCm39) H322Q probably damaging Het
Zkscan8 A T 13: 21,706,441 (GRCm39) S212T probably benign Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62,595,035 (GRCm39) missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62,564,598 (GRCm39) missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62,680,720 (GRCm39) missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62,607,983 (GRCm39) missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62,564,628 (GRCm39) missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62,667,507 (GRCm39) missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62,552,132 (GRCm39) missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62,569,706 (GRCm39) missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62,536,402 (GRCm39) missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62,680,781 (GRCm39) missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62,618,029 (GRCm39) nonsense probably null
IGL02989:Kcnh7 APN 2 62,552,269 (GRCm39) missense probably benign
IGL02990:Kcnh7 APN 2 62,536,330 (GRCm39) missense probably benign 0.11
G1citation:Kcnh7 UTSW 2 62,618,248 (GRCm39) missense probably damaging 1.00
LCD18:Kcnh7 UTSW 2 62,880,143 (GRCm39) intron probably benign
R0622:Kcnh7 UTSW 2 62,667,633 (GRCm39) splice site probably null
R0638:Kcnh7 UTSW 2 62,607,854 (GRCm39) missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62,546,527 (GRCm39) missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62,607,739 (GRCm39) missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62,607,755 (GRCm39) missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62,680,948 (GRCm39) missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62,566,513 (GRCm39) missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62,607,736 (GRCm39) missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62,618,098 (GRCm39) missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62,607,950 (GRCm39) missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62,552,261 (GRCm39) missense probably benign
R2988:Kcnh7 UTSW 2 62,552,172 (GRCm39) missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62,595,007 (GRCm39) missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62,552,261 (GRCm39) missense probably benign
R4415:Kcnh7 UTSW 2 62,536,417 (GRCm39) missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62,569,530 (GRCm39) missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62,667,439 (GRCm39) missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62,546,564 (GRCm39) missense probably benign
R4990:Kcnh7 UTSW 2 62,564,632 (GRCm39) missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62,569,508 (GRCm39) missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62,546,582 (GRCm39) missense probably benign
R5996:Kcnh7 UTSW 2 63,014,441 (GRCm39) start gained probably benign
R6142:Kcnh7 UTSW 2 62,569,704 (GRCm39) missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62,607,903 (GRCm39) missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63,012,570 (GRCm39) missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62,594,960 (GRCm39) nonsense probably null
R6400:Kcnh7 UTSW 2 62,569,688 (GRCm39) missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62,680,876 (GRCm39) missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62,676,118 (GRCm39) missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62,607,940 (GRCm39) missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62,680,721 (GRCm39) missense probably benign
R6822:Kcnh7 UTSW 2 62,618,248 (GRCm39) missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62,618,029 (GRCm39) missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62,618,031 (GRCm39) missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62,707,614 (GRCm39) missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62,566,314 (GRCm39) splice site probably null
R7657:Kcnh7 UTSW 2 62,566,379 (GRCm39) missense probably damaging 1.00
R7855:Kcnh7 UTSW 2 62,667,538 (GRCm39) nonsense probably null
R7968:Kcnh7 UTSW 2 62,566,444 (GRCm39) missense probably damaging 1.00
R8183:Kcnh7 UTSW 2 62,533,321 (GRCm39) missense probably damaging 0.99
R8343:Kcnh7 UTSW 2 62,680,879 (GRCm39) missense probably benign 0.01
R8405:Kcnh7 UTSW 2 62,533,446 (GRCm39) missense probably benign 0.04
R8411:Kcnh7 UTSW 2 62,594,952 (GRCm39) missense probably damaging 1.00
R8493:Kcnh7 UTSW 2 62,681,003 (GRCm39) missense probably benign 0.31
R8744:Kcnh7 UTSW 2 63,012,433 (GRCm39) missense possibly damaging 0.93
R8988:Kcnh7 UTSW 2 62,552,209 (GRCm39) missense
R9082:Kcnh7 UTSW 2 62,607,878 (GRCm39) missense probably damaging 1.00
R9206:Kcnh7 UTSW 2 62,607,947 (GRCm39) missense probably damaging 1.00
R9272:Kcnh7 UTSW 2 62,618,097 (GRCm39) missense probably damaging 0.99
R9382:Kcnh7 UTSW 2 62,667,612 (GRCm39) missense probably benign 0.01
R9674:Kcnh7 UTSW 2 62,595,060 (GRCm39) missense probably damaging 1.00
R9771:Kcnh7 UTSW 2 62,569,719 (GRCm39) missense probably damaging 1.00
X0011:Kcnh7 UTSW 2 62,595,067 (GRCm39) missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 63,014,412 (GRCm39) missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 62,566,447 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAACATAGGTTGCTTGATGGCAAAA -3'
(R):5'- AGGTGACTCCTTAGCTCAACACCAG -3'

Sequencing Primer
(F):5'- GCTTGATGGCAAAAGTATCCTG -3'
(R):5'- CTGGCTCTTAAGTCAAAGATTCTGG -3'
Posted On 2013-04-11