Incidental Mutation 'R0129:Kcnh7'
ID21543
Institutional Source Beutler Lab
Gene Symbol Kcnh7
Ensembl Gene ENSMUSG00000059742
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 7
SynonymsKv11.3, 9330137I11Rik, erg3
MMRRC Submission 038414-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R0129 (G1)
Quality Score148
Status Validated (trace)
Chromosome2
Chromosomal Location62693414-63184287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62716159 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 1026 (T1026I)
Ref Sequence ENSEMBL: ENSMUSP00000074563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075052]
Predicted Effect probably benign
Transcript: ENSMUST00000075052
AA Change: T1026I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000074563
Gene: ENSMUSG00000059742
AA Change: T1026I

DomainStartEndE-ValueType
PAS 20 87 8.97e0 SMART
PAC 93 135 3.48e-1 SMART
Pfam:Ion_trans 407 674 4.9e-39 PFAM
Pfam:Ion_trans_2 588 668 3.2e-13 PFAM
cNMP 745 863 1.5e-23 SMART
low complexity region 921 940 N/A INTRINSIC
coiled coil region 1022 1058 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
Meta Mutation Damage Score 0.1068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. There are at least two alternatively spliced transcript variants derived from this gene and encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,787,194 D31G probably damaging Het
Actr2 A G 11: 20,100,939 probably benign Het
Adcy8 A G 15: 64,747,013 C764R probably benign Het
Ago4 A C 4: 126,517,183 F171C possibly damaging Het
Akt2 T C 7: 27,636,970 F408S probably damaging Het
Ankrd24 T C 10: 81,638,329 L26P probably damaging Het
Appl1 A T 14: 26,928,643 M524K probably damaging Het
Arhgef11 T A 3: 87,728,063 I922N probably damaging Het
Atp5h T C 11: 115,417,918 E47G probably damaging Het
Birc6 A G 17: 74,528,760 D70G probably benign Het
Bola2 G A 7: 126,696,559 V56M probably damaging Het
Ccdc151 G T 9: 21,993,552 R313S probably damaging Het
Cd300lg A G 11: 102,054,092 probably null Het
Cdc42bpb A G 12: 111,304,959 probably benign Het
Ceacam20 A G 7: 19,976,260 N403S probably damaging Het
Cenpf T C 1: 189,659,650 M662V probably benign Het
Chd3 C A 11: 69,348,501 E1607* probably null Het
Chtf18 A T 17: 25,727,311 Y9* probably null Het
Clta A G 4: 44,032,424 N200S probably benign Het
Csmd1 G A 8: 16,079,942 S1722F possibly damaging Het
Dennd4a T C 9: 64,893,294 S905P probably damaging Het
Dhx57 T C 17: 80,238,914 K1347R probably damaging Het
Dmc1 A T 15: 79,596,240 probably benign Het
Dnhd1 G T 7: 105,720,924 A4519S probably benign Het
Dnmbp A G 19: 43,850,027 C1120R probably benign Het
Efs C T 14: 54,917,223 A427T probably damaging Het
Erich6 T C 3: 58,624,378 E399G probably damaging Het
Espl1 A G 15: 102,316,648 T1431A probably benign Het
Fam184b A G 5: 45,532,778 S830P probably damaging Het
Fam49a C T 12: 12,362,349 T204I probably damaging Het
Herc1 T A 9: 66,448,075 C2203S probably damaging Het
Itpr1 G A 6: 108,349,676 V120M probably damaging Het
Kif1b A G 4: 149,261,201 I394T probably benign Het
Ldlrap1 A C 4: 134,757,422 V87G probably damaging Het
Lgals12 C T 19: 7,603,038 V155I probably damaging Het
Limch1 A T 5: 66,959,590 N116I probably damaging Het
Lonp2 C T 8: 86,634,890 R232C probably damaging Het
Lrch1 C A 14: 74,835,746 C151F probably benign Het
Lrig3 A G 10: 126,006,943 Y579C probably damaging Het
Macf1 T C 4: 123,433,275 S4808G probably damaging Het
Mapkap1 A T 2: 34,623,482 K501N probably damaging Het
Mdc1 G T 17: 35,854,445 R1523L probably benign Het
Mlh3 C T 12: 85,266,140 probably benign Het
Mul1 T C 4: 138,437,721 probably benign Het
Mybl2 G A 2: 163,059,491 probably benign Het
Notch1 G C 2: 26,460,458 H2223Q probably benign Het
Notch2 C A 3: 98,146,620 L2200M probably benign Het
Olfr1329 A T 4: 118,917,470 probably null Het
Olfr160 T C 9: 37,711,940 Y113C probably damaging Het
Olfr291 T A 7: 84,856,988 F206L probably benign Het
Olfr358 G A 2: 37,005,045 R190* probably null Het
Plekhs1 T C 19: 56,477,290 probably null Het
Ppm1h G A 10: 122,941,355 G509R probably damaging Het
Ppp2r3c C T 12: 55,298,422 E94K probably damaging Het
Ppp2r5e T A 12: 75,462,390 I372F probably damaging Het
Ptprt G A 2: 162,278,070 T159I probably benign Het
Rab20 A G 8: 11,454,415 F95S probably damaging Het
Rfc3 A C 5: 151,651,151 M1R probably null Het
Skp2 A G 15: 9,125,193 S100P probably damaging Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sspo A T 6: 48,455,418 T684S probably benign Het
Syt3 A G 7: 44,393,358 K355E probably damaging Het
Tcp10a A T 17: 7,343,504 K355N probably damaging Het
Tnrc18 A G 5: 142,765,045 probably benign Het
Tsfm A G 10: 127,030,470 L74P probably benign Het
Ttn G C 2: 76,734,265 N28509K probably damaging Het
Ube2l6 G A 2: 84,798,908 M1I probably null Het
Vmn2r80 T A 10: 79,169,496 H322Q probably damaging Het
Zkscan8 A T 13: 21,522,271 S212T probably benign Het
Other mutations in Kcnh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Kcnh7 APN 2 62764691 missense probably benign 0.01
IGL00693:Kcnh7 APN 2 62734254 missense probably benign 0.06
IGL00776:Kcnh7 APN 2 62850376 missense probably benign 0.00
IGL00956:Kcnh7 APN 2 62777639 missense probably damaging 1.00
IGL01651:Kcnh7 APN 2 62734284 missense possibly damaging 0.47
IGL01780:Kcnh7 APN 2 62837163 missense probably benign 0.17
IGL01859:Kcnh7 APN 2 62721788 missense probably benign 0.00
IGL02213:Kcnh7 APN 2 62739362 missense probably damaging 1.00
IGL02302:Kcnh7 APN 2 62706058 missense probably damaging 1.00
IGL02526:Kcnh7 APN 2 62850437 missense possibly damaging 0.46
IGL02850:Kcnh7 APN 2 62787685 nonsense probably null
IGL02989:Kcnh7 APN 2 62721925 missense probably benign
IGL02990:Kcnh7 APN 2 62705986 missense probably benign 0.11
G1citation:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
LCD18:Kcnh7 UTSW 2 63049799 intron probably benign
R0622:Kcnh7 UTSW 2 62837289 splice site probably null
R0638:Kcnh7 UTSW 2 62777510 missense probably benign 0.13
R1006:Kcnh7 UTSW 2 62716183 missense probably benign 0.00
R1200:Kcnh7 UTSW 2 62777395 missense probably damaging 1.00
R1330:Kcnh7 UTSW 2 62777411 missense possibly damaging 0.56
R1614:Kcnh7 UTSW 2 62850604 missense probably benign 0.03
R1782:Kcnh7 UTSW 2 62736169 missense probably damaging 1.00
R1861:Kcnh7 UTSW 2 62777392 missense probably damaging 0.97
R1862:Kcnh7 UTSW 2 62787754 missense possibly damaging 0.46
R2197:Kcnh7 UTSW 2 62777606 missense probably damaging 1.00
R2510:Kcnh7 UTSW 2 62721917 missense probably benign
R2988:Kcnh7 UTSW 2 62721828 missense probably benign 0.20
R3024:Kcnh7 UTSW 2 62764663 missense probably damaging 1.00
R3433:Kcnh7 UTSW 2 62721917 missense probably benign
R4415:Kcnh7 UTSW 2 62706073 missense probably damaging 1.00
R4540:Kcnh7 UTSW 2 62739186 missense probably damaging 1.00
R4570:Kcnh7 UTSW 2 62837095 missense possibly damaging 0.91
R4827:Kcnh7 UTSW 2 62716220 missense probably benign
R4990:Kcnh7 UTSW 2 62734288 missense probably benign 0.00
R5172:Kcnh7 UTSW 2 62739164 missense possibly damaging 0.88
R5822:Kcnh7 UTSW 2 62716238 missense probably benign
R5996:Kcnh7 UTSW 2 63184097 start gained probably benign
R6142:Kcnh7 UTSW 2 62739360 missense possibly damaging 0.95
R6226:Kcnh7 UTSW 2 62777559 missense probably damaging 1.00
R6244:Kcnh7 UTSW 2 63182226 missense probably damaging 1.00
R6304:Kcnh7 UTSW 2 62764616 nonsense probably null
R6400:Kcnh7 UTSW 2 62739344 missense probably damaging 1.00
R6430:Kcnh7 UTSW 2 62850532 missense probably benign 0.04
R6483:Kcnh7 UTSW 2 62845774 missense probably benign 0.06
R6614:Kcnh7 UTSW 2 62777596 missense probably damaging 1.00
R6753:Kcnh7 UTSW 2 62850377 missense probably benign
R6822:Kcnh7 UTSW 2 62787904 missense probably damaging 1.00
R6863:Kcnh7 UTSW 2 62787685 missense possibly damaging 0.83
R7104:Kcnh7 UTSW 2 62787687 missense possibly damaging 0.82
R7116:Kcnh7 UTSW 2 62877270 missense probably benign 0.02
R7263:Kcnh7 UTSW 2 62735970 splice site probably null
R7657:Kcnh7 UTSW 2 62736035 missense probably damaging 1.00
R7855:Kcnh7 UTSW 2 62837194 nonsense probably null
R7968:Kcnh7 UTSW 2 62736100 missense probably damaging 1.00
R8183:Kcnh7 UTSW 2 62702977 missense probably damaging 0.99
R8343:Kcnh7 UTSW 2 62850535 missense probably benign 0.01
R8405:Kcnh7 UTSW 2 62703102 missense probably benign 0.04
R8411:Kcnh7 UTSW 2 62764608 missense probably damaging 1.00
R8493:Kcnh7 UTSW 2 62850659 missense probably benign 0.31
R8744:Kcnh7 UTSW 2 63182089 missense possibly damaging 0.93
X0011:Kcnh7 UTSW 2 62764723 missense probably damaging 0.99
Z1088:Kcnh7 UTSW 2 62736103 missense probably damaging 1.00
Z1088:Kcnh7 UTSW 2 63184068 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAACATAGGTTGCTTGATGGCAAAA -3'
(R):5'- AGGTGACTCCTTAGCTCAACACCAG -3'

Sequencing Primer
(F):5'- GCTTGATGGCAAAAGTATCCTG -3'
(R):5'- CTGGCTCTTAAGTCAAAGATTCTGG -3'
Posted On2013-04-11