Incidental Mutation 'R1932:Grb14'
ID215431
Institutional Source Beutler Lab
Gene Symbol Grb14
Ensembl Gene ENSMUSG00000026888
Gene Namegrowth factor receptor bound protein 14
Synonyms
MMRRC Submission 039950-MU
Accession Numbers

Ncbi RefSeq: NM_016719.1; MGI:1355324

Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R1932 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location64912476-65024987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64912802 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 508 (F508L)
Ref Sequence ENSEMBL: ENSMUSP00000028252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028252] [ENSMUST00000149193] [ENSMUST00000150643]
Predicted Effect probably damaging
Transcript: ENSMUST00000028252
AA Change: F508L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028252
Gene: ENSMUSG00000026888
AA Change: F508L

DomainStartEndE-ValueType
RA 104 190 2.88e-23 SMART
PH 233 342 1.91e-10 SMART
Pfam:BPS 367 415 1.5e-31 PFAM
SH2 435 524 5.34e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134020
Predicted Effect probably benign
Transcript: ENSMUST00000149193
SMART Domains Protein: ENSMUSP00000118115
Gene: ENSMUSG00000026888

DomainStartEndE-ValueType
Pfam:BPS 1 24 3e-13 PFAM
SH2 44 108 2.54e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150643
SMART Domains Protein: ENSMUSP00000121571
Gene: ENSMUSG00000026888

DomainStartEndE-ValueType
Pfam:BPS 1 49 3.1e-34 PFAM
SCOP:d1a81a2 51 93 3e-8 SMART
Blast:RA 61 93 1e-12 BLAST
PDB:2AUG|B 65 93 4e-12 PDB
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype Strain: 3029164
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with insulin receptors and insulin-like growth-factor receptors. This protein likely has an inhibitory effect on receptor tyrosine kinase signaling and, in particular, on insulin receptor signaling. This gene may play a role in signaling pathways that regulate growth and metabolism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous mutation of this gene results in improved glucose tolerance, lower circulating insulin levels and increased incorporation of glucose into glycogen in the liver and skeletal muscle of males. Both males and females exhibit a decrease in body size. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,279,394 Q278H probably benign Het
Ace3 T C 11: 106,004,610 probably null Het
Aco1 T C 4: 40,176,499 V221A probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamts8 A G 9: 30,956,512 D544G probably benign Het
Angptl4 C A 17: 33,781,275 E40* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip2 T A 16: 10,241,703 I369N possibly damaging Het
Atp6ap1l T A 13: 90,883,687 Y292F probably damaging Het
Atp6v1b2 A T 8: 69,102,807 K217* probably null Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Blvra T A 2: 127,095,148 W174R probably damaging Het
Catsperg1 C T 7: 29,198,143 G239R probably damaging Het
Ccdc157 G T 11: 4,146,549 A400D probably damaging Het
Chd2 G T 7: 73,454,445 P1298T probably damaging Het
CK137956 G A 4: 127,946,858 L352F possibly damaging Het
Col22a1 G A 15: 71,870,140 P503S unknown Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Crem C T 18: 3,299,284 G47R probably benign Het
Crygs T A 16: 22,806,554 T46S probably benign Het
Cts8 T A 13: 61,253,615 H62L probably damaging Het
Cyp4a32 T A 4: 115,611,277 F319I possibly damaging Het
Dchs1 T C 7: 105,765,902 S692G probably damaging Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Defa29 A T 8: 21,326,849 S43T probably damaging Het
Dnajc14 A G 10: 128,816,792 D573G probably damaging Het
Drd5 A G 5: 38,319,976 Y104C probably benign Het
Efcab7 C T 4: 99,911,018 P102L probably damaging Het
Efhc1 A G 1: 20,967,400 Y267C probably damaging Het
Eif2ak4 T C 2: 118,448,486 Y243H probably damaging Het
Gfm2 T A 13: 97,141,967 I7N probably damaging Het
Gmds A G 13: 32,127,997 F150L possibly damaging Het
Gp2 T C 7: 119,454,232 T169A possibly damaging Het
Hdac5 T A 11: 102,195,872 probably benign Het
Heatr1 T A 13: 12,435,185 M620K probably damaging Het
Herc3 A G 6: 58,876,793 E608G probably damaging Het
Hoxb4 T C 11: 96,320,041 Y156H probably damaging Het
Ifi205 T A 1: 174,028,414 I17F possibly damaging Het
Il2rb A T 15: 78,491,777 S25T possibly damaging Het
Kansl1 T C 11: 104,335,097 T998A probably damaging Het
Kcna6 G T 6: 126,738,488 H479Q probably benign Het
Kif2a T C 13: 106,978,091 K350R probably benign Het
Lct G T 1: 128,294,161 A1547E probably damaging Het
Lhx9 T A 1: 138,842,009 probably benign Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Lrp4 G A 2: 91,497,355 W1516* probably null Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Ltbp1 T A 17: 75,313,034 D719E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Macf1 A G 4: 123,452,037 I1326T probably damaging Het
Manba T C 3: 135,544,740 F376S probably benign Het
Mink1 T C 11: 70,608,428 probably null Het
Nfatc2ip C T 7: 126,384,992 V410I probably damaging Het
Nlrp1b A T 11: 71,182,138 I293N probably damaging Het
Olfr432 T C 1: 174,050,678 Y102H probably damaging Het
Otol1 A C 3: 70,028,104 E476D probably benign Het
Pcdhb4 C T 18: 37,309,541 P635S probably benign Het
Pfkfb4 T A 9: 108,999,169 F91I probably damaging Het
Polq G A 16: 37,062,304 R1610Q possibly damaging Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Ppp1r15b C T 1: 133,131,625 probably benign Het
Prkca T G 11: 108,192,149 D90A probably benign Het
Sall3 T C 18: 80,969,753 D1156G probably benign Het
Scn7a A T 2: 66,676,102 L1481H probably damaging Het
Selenon A T 4: 134,544,618 I292N probably damaging Het
Sema6d T A 2: 124,659,886 probably null Het
Sgpp1 G T 12: 75,716,179 Y409* probably null Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc25a13 A G 6: 6,042,264 V638A probably benign Het
Snhg11 T C 2: 158,376,826 probably benign Het
Sorbs2 A G 8: 45,796,352 Q800R probably benign Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Swap70 C T 7: 110,279,263 A480V possibly damaging Het
Sycp2 A G 2: 178,381,957 V422A probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet3 T C 6: 83,404,379 N269S possibly damaging Het
Thap12 A T 7: 98,716,838 I738F possibly damaging Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmem229a A T 6: 24,955,011 F248Y probably damaging Het
Tmprss7 G A 16: 45,684,593 Q145* probably null Het
Tnc A T 4: 63,993,025 probably null Het
Tonsl A T 15: 76,624,597 Y21N probably damaging Het
Tpr A G 1: 150,421,663 D1009G probably benign Het
Trpm2 G A 10: 77,941,158 A435V probably damaging Het
Ubr3 T A 2: 69,953,476 probably null Het
Vcan T C 13: 89,705,534 N436D possibly damaging Het
Vmn2r104 T A 17: 20,040,769 Y464F probably damaging Het
Vmn2r44 T A 7: 8,367,982 R688S probably benign Het
Wdr74 G T 19: 8,737,947 V157L probably benign Het
Wnt7a T A 6: 91,394,548 D144V probably benign Het
Zfp106 C T 2: 120,531,681 A986T possibly damaging Het
Other mutations in Grb14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Grb14 APN 2 64914718 missense probably damaging 1.00
IGL02267:Grb14 APN 2 64953616 missense probably damaging 1.00
IGL02902:Grb14 APN 2 64938418 missense probably damaging 1.00
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0066:Grb14 UTSW 2 64938492 critical splice acceptor site probably null
R0658:Grb14 UTSW 2 64914727 nonsense probably null
R0681:Grb14 UTSW 2 64917287 missense probably damaging 1.00
R1215:Grb14 UTSW 2 64917264 missense probably benign 0.01
R1781:Grb14 UTSW 2 64975555 critical splice donor site probably null
R2034:Grb14 UTSW 2 64923529 splice site probably benign
R4405:Grb14 UTSW 2 64953622 missense probably damaging 1.00
R4505:Grb14 UTSW 2 65022568 missense probably damaging 0.97
R4580:Grb14 UTSW 2 64953603 missense probably benign 0.29
R5216:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5367:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5369:Grb14 UTSW 2 64917309 missense probably benign 0.00
R5382:Grb14 UTSW 2 64914734 missense probably damaging 1.00
R5457:Grb14 UTSW 2 64917098 missense probably damaging 1.00
R5816:Grb14 UTSW 2 64917284 missense probably damaging 1.00
R6062:Grb14 UTSW 2 65022620 missense possibly damaging 0.77
R7114:Grb14 UTSW 2 64916853 missense probably damaging 1.00
X0021:Grb14 UTSW 2 64936425 missense probably null 0.26
Predicted Primers PCR Primer
(F):5'- ACCATGATTTGTTTTCAGCCTTGTG -3'
(R):5'- GGCACGATGCTATTCTCATTGTC -3'

Sequencing Primer
(F):5'- GATTTGTTTTCAGCCTTGTGATCTC -3'
(R):5'- GGCTTATGAACACATAGTATGCAG -3'
Posted On2014-07-14