Incidental Mutation 'R1932:Zfp106'
ID215437
Institutional Source Beutler Lab
Gene Symbol Zfp106
Ensembl Gene ENSMUSG00000027288
Gene Namezinc finger protein 106
SynonymsCd-1, H3a, Sh3bp3, sirm
MMRRC Submission 039950-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1932 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location120506820-120563843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120531681 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 986 (A986T)
Ref Sequence ENSEMBL: ENSMUSP00000128995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055241
AA Change: A1009T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: A1009T

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
ZnF_C2H2 43 67 7.18e1 SMART
low complexity region 75 92 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 199 212 N/A INTRINSIC
low complexity region 466 480 N/A INTRINSIC
coiled coil region 800 823 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1049 1062 N/A INTRINSIC
low complexity region 1312 1321 N/A INTRINSIC
low complexity region 1361 1373 N/A INTRINSIC
low complexity region 1389 1409 N/A INTRINSIC
WD40 1525 1562 9.24e-4 SMART
WD40 1565 1607 1.83e-7 SMART
PQQ 1587 1618 3.42e2 SMART
WD40 1651 1691 3.45e-1 SMART
PQQ 1671 1702 9.14e1 SMART
WD40 1694 1731 2.12e-3 SMART
PQQ 1711 1742 6.42e0 SMART
WD40 1734 1771 6e-3 SMART
PQQ 1751 1782 5.7e2 SMART
WD40 1774 1811 3.58e-1 SMART
ZnF_C2H2 1818 1843 5.34e-1 SMART
ZnF_C2H2 1851 1879 1.31e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135625
SMART Domains Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 5 29 1.51e0 SMART
low complexity region 53 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149210
Predicted Effect unknown
Transcript: ENSMUST00000163384
AA Change: A126T
Predicted Effect probably benign
Transcript: ENSMUST00000167241
SMART Domains Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

DomainStartEndE-ValueType
ZnF_C2H2 4 28 1.51e0 SMART
low complexity region 74 85 N/A INTRINSIC
low complexity region 132 145 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171215
AA Change: A986T

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: A986T

DomainStartEndE-ValueType
ZnF_C2H2 20 44 7.18e1 SMART
low complexity region 52 69 N/A INTRINSIC
low complexity region 118 129 N/A INTRINSIC
low complexity region 176 189 N/A INTRINSIC
low complexity region 443 457 N/A INTRINSIC
coiled coil region 777 800 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1289 1298 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1366 1386 N/A INTRINSIC
WD40 1502 1539 9.24e-4 SMART
WD40 1542 1584 1.83e-7 SMART
PQQ 1564 1595 3.42e2 SMART
WD40 1628 1668 3.45e-1 SMART
PQQ 1648 1679 9.14e1 SMART
WD40 1671 1708 2.12e-3 SMART
PQQ 1688 1719 6.42e0 SMART
WD40 1711 1748 6e-3 SMART
PQQ 1728 1759 5.7e2 SMART
WD40 1751 1788 3.58e-1 SMART
ZnF_C2H2 1795 1820 5.34e-1 SMART
ZnF_C2H2 1828 1856 1.31e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181963
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,279,394 Q278H probably benign Het
Ace3 T C 11: 106,004,610 probably null Het
Aco1 T C 4: 40,176,499 V221A probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamts8 A G 9: 30,956,512 D544G probably benign Het
Angptl4 C A 17: 33,781,275 E40* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip2 T A 16: 10,241,703 I369N possibly damaging Het
Atp6ap1l T A 13: 90,883,687 Y292F probably damaging Het
Atp6v1b2 A T 8: 69,102,807 K217* probably null Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Blvra T A 2: 127,095,148 W174R probably damaging Het
Catsperg1 C T 7: 29,198,143 G239R probably damaging Het
Ccdc157 G T 11: 4,146,549 A400D probably damaging Het
Chd2 G T 7: 73,454,445 P1298T probably damaging Het
CK137956 G A 4: 127,946,858 L352F possibly damaging Het
Col22a1 G A 15: 71,870,140 P503S unknown Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Crem C T 18: 3,299,284 G47R probably benign Het
Crygs T A 16: 22,806,554 T46S probably benign Het
Cts8 T A 13: 61,253,615 H62L probably damaging Het
Cyp4a32 T A 4: 115,611,277 F319I possibly damaging Het
Dchs1 T C 7: 105,765,902 S692G probably damaging Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Defa29 A T 8: 21,326,849 S43T probably damaging Het
Dnajc14 A G 10: 128,816,792 D573G probably damaging Het
Drd5 A G 5: 38,319,976 Y104C probably benign Het
Efcab7 C T 4: 99,911,018 P102L probably damaging Het
Efhc1 A G 1: 20,967,400 Y267C probably damaging Het
Eif2ak4 T C 2: 118,448,486 Y243H probably damaging Het
Gfm2 T A 13: 97,141,967 I7N probably damaging Het
Gmds A G 13: 32,127,997 F150L possibly damaging Het
Gp2 T C 7: 119,454,232 T169A possibly damaging Het
Grb14 A G 2: 64,912,802 F508L probably damaging Het
Hdac5 T A 11: 102,195,872 probably benign Het
Heatr1 T A 13: 12,435,185 M620K probably damaging Het
Herc3 A G 6: 58,876,793 E608G probably damaging Het
Hoxb4 T C 11: 96,320,041 Y156H probably damaging Het
Ifi205 T A 1: 174,028,414 I17F possibly damaging Het
Il2rb A T 15: 78,491,777 S25T possibly damaging Het
Kansl1 T C 11: 104,335,097 T998A probably damaging Het
Kcna6 G T 6: 126,738,488 H479Q probably benign Het
Kif2a T C 13: 106,978,091 K350R probably benign Het
Lct G T 1: 128,294,161 A1547E probably damaging Het
Lhx9 T A 1: 138,842,009 probably benign Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Lrp4 G A 2: 91,497,355 W1516* probably null Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Ltbp1 T A 17: 75,313,034 D719E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Macf1 A G 4: 123,452,037 I1326T probably damaging Het
Manba T C 3: 135,544,740 F376S probably benign Het
Mink1 T C 11: 70,608,428 probably null Het
Nfatc2ip C T 7: 126,384,992 V410I probably damaging Het
Nlrp1b A T 11: 71,182,138 I293N probably damaging Het
Olfr432 T C 1: 174,050,678 Y102H probably damaging Het
Otol1 A C 3: 70,028,104 E476D probably benign Het
Pcdhb4 C T 18: 37,309,541 P635S probably benign Het
Pfkfb4 T A 9: 108,999,169 F91I probably damaging Het
Polq G A 16: 37,062,304 R1610Q possibly damaging Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Ppp1r15b C T 1: 133,131,625 probably benign Het
Prkca T G 11: 108,192,149 D90A probably benign Het
Sall3 T C 18: 80,969,753 D1156G probably benign Het
Scn7a A T 2: 66,676,102 L1481H probably damaging Het
Selenon A T 4: 134,544,618 I292N probably damaging Het
Sema6d T A 2: 124,659,886 probably null Het
Sgpp1 G T 12: 75,716,179 Y409* probably null Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc25a13 A G 6: 6,042,264 V638A probably benign Het
Snhg11 T C 2: 158,376,826 probably benign Het
Sorbs2 A G 8: 45,796,352 Q800R probably benign Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Swap70 C T 7: 110,279,263 A480V possibly damaging Het
Sycp2 A G 2: 178,381,957 V422A probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet3 T C 6: 83,404,379 N269S possibly damaging Het
Thap12 A T 7: 98,716,838 I738F possibly damaging Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmem229a A T 6: 24,955,011 F248Y probably damaging Het
Tmprss7 G A 16: 45,684,593 Q145* probably null Het
Tnc A T 4: 63,993,025 probably null Het
Tonsl A T 15: 76,624,597 Y21N probably damaging Het
Tpr A G 1: 150,421,663 D1009G probably benign Het
Trpm2 G A 10: 77,941,158 A435V probably damaging Het
Ubr3 T A 2: 69,953,476 probably null Het
Vcan T C 13: 89,705,534 N436D possibly damaging Het
Vmn2r104 T A 17: 20,040,769 Y464F probably damaging Het
Vmn2r44 T A 7: 8,367,982 R688S probably benign Het
Wdr74 G T 19: 8,737,947 V157L probably benign Het
Wnt7a T A 6: 91,394,548 D144V probably benign Het
Other mutations in Zfp106
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Zfp106 APN 2 120539497 missense probably benign 0.45
IGL00816:Zfp106 APN 2 120526848 missense probably benign 0.02
IGL00822:Zfp106 APN 2 120514160 missense probably damaging 1.00
IGL00848:Zfp106 APN 2 120512727 missense probably damaging 1.00
IGL01293:Zfp106 APN 2 120535035 missense possibly damaging 0.92
IGL01323:Zfp106 APN 2 120524464 missense possibly damaging 0.74
IGL01662:Zfp106 APN 2 120523553 missense probably benign 0.17
IGL01683:Zfp106 APN 2 120524555 missense probably benign 0.00
IGL01809:Zfp106 APN 2 120533671 missense probably damaging 1.00
IGL01958:Zfp106 APN 2 120534807 missense probably benign 0.26
IGL01960:Zfp106 APN 2 120524043 missense probably damaging 0.99
IGL01960:Zfp106 APN 2 120539322 missense probably benign 0.08
IGL02168:Zfp106 APN 2 120534231 missense possibly damaging 0.90
IGL02623:Zfp106 APN 2 120545914 splice site probably null
IGL02798:Zfp106 APN 2 120510510 missense probably damaging 1.00
IGL02828:Zfp106 APN 2 120531697 missense possibly damaging 0.86
IGL03022:Zfp106 APN 2 120528639 splice site probably benign
IGL03308:Zfp106 APN 2 120524024 missense probably benign 0.00
IGL03324:Zfp106 APN 2 120535387 missense probably benign 0.01
lepton UTSW 2 120532104 missense probably damaging 0.98
Proton UTSW 2 120510534 missense probably damaging 1.00
quark UTSW 2 120535060 nonsense probably null
R0040_zfp106_031 UTSW 2 120531613 missense probably damaging 1.00
string UTSW 2 120533594 missense probably damaging 0.96
theory UTSW 2 120533677 nonsense probably null
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0040:Zfp106 UTSW 2 120531613 missense probably damaging 1.00
R0135:Zfp106 UTSW 2 120520487 missense probably damaging 0.99
R0180:Zfp106 UTSW 2 120533875 missense probably damaging 0.96
R0387:Zfp106 UTSW 2 120528472 splice site probably null
R0558:Zfp106 UTSW 2 120532196 missense probably damaging 1.00
R0680:Zfp106 UTSW 2 120527016 missense probably damaging 1.00
R0729:Zfp106 UTSW 2 120555248 missense probably damaging 0.99
R0828:Zfp106 UTSW 2 120535603 missense probably benign 0.00
R1124:Zfp106 UTSW 2 120534714 missense probably benign 0.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1147:Zfp106 UTSW 2 120520536 missense probably damaging 1.00
R1226:Zfp106 UTSW 2 120524079 missense probably damaging 1.00
R1239:Zfp106 UTSW 2 120533594 missense probably damaging 0.96
R1634:Zfp106 UTSW 2 120533677 nonsense probably null
R1754:Zfp106 UTSW 2 120533763 missense probably damaging 0.96
R1754:Zfp106 UTSW 2 120533764 missense probably damaging 0.98
R1755:Zfp106 UTSW 2 120535175 missense probably damaging 1.00
R1763:Zfp106 UTSW 2 120520428 missense probably benign 0.03
R1875:Zfp106 UTSW 2 120513615 critical splice donor site probably null
R1903:Zfp106 UTSW 2 120526848 missense probably benign 0.02
R2070:Zfp106 UTSW 2 120523529 missense probably benign 0.11
R2301:Zfp106 UTSW 2 120535650 missense probably benign 0.04
R3429:Zfp106 UTSW 2 120527063 missense probably benign 0.00
R3720:Zfp106 UTSW 2 120534599 missense probably benign 0.01
R3875:Zfp106 UTSW 2 120534613 missense probably benign 0.08
R3881:Zfp106 UTSW 2 120532149 missense probably benign 0.01
R3921:Zfp106 UTSW 2 120533616 missense probably damaging 1.00
R3923:Zfp106 UTSW 2 120534856 missense probably damaging 0.99
R4087:Zfp106 UTSW 2 120526899 splice site probably null
R4678:Zfp106 UTSW 2 120533740 missense probably damaging 1.00
R4965:Zfp106 UTSW 2 120533919 missense probably damaging 0.98
R5011:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5013:Zfp106 UTSW 2 120510534 missense probably damaging 1.00
R5151:Zfp106 UTSW 2 120534727 missense probably benign 0.01
R5227:Zfp106 UTSW 2 120523968 missense probably benign 0.11
R5328:Zfp106 UTSW 2 120520417 missense possibly damaging 0.73
R5403:Zfp106 UTSW 2 120534781 missense probably benign 0.02
R5624:Zfp106 UTSW 2 120531957 missense probably damaging 0.99
R5686:Zfp106 UTSW 2 120533507 splice site probably null
R5691:Zfp106 UTSW 2 120524471 missense probably damaging 0.99
R5852:Zfp106 UTSW 2 120516006 missense probably damaging 1.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6032:Zfp106 UTSW 2 120535393 missense probably benign 0.00
R6298:Zfp106 UTSW 2 120522704 missense probably damaging 1.00
R6409:Zfp106 UTSW 2 120532104 missense probably damaging 0.98
R6505:Zfp106 UTSW 2 120534502 missense probably damaging 0.99
R6598:Zfp106 UTSW 2 120535060 nonsense probably null
R6765:Zfp106 UTSW 2 120539454 missense probably damaging 0.96
R7013:Zfp106 UTSW 2 120531632 missense probably damaging 0.99
R7453:Zfp106 UTSW 2 120510527 missense probably damaging 1.00
R7453:Zfp106 UTSW 2 120545919 splice site probably null
R7643:Zfp106 UTSW 2 120512734 missense probably benign 0.01
R7829:Zfp106 UTSW 2 120524057 missense possibly damaging 0.94
R7897:Zfp106 UTSW 2 120535615 nonsense probably null
R7909:Zfp106 UTSW 2 120514219 missense probably damaging 1.00
R8054:Zfp106 UTSW 2 120524519 missense possibly damaging 0.93
R8124:Zfp106 UTSW 2 120524331 missense probably benign 0.44
R8203:Zfp106 UTSW 2 120519078 missense probably damaging 1.00
R8350:Zfp106 UTSW 2 120535618 missense
R8450:Zfp106 UTSW 2 120535618 missense
R8698:Zfp106 UTSW 2 120524119 critical splice donor site probably null
RF008:Zfp106 UTSW 2 120524545 small deletion probably benign
RF025:Zfp106 UTSW 2 120524545 small deletion probably benign
X0025:Zfp106 UTSW 2 120534816 missense probably benign
Z1088:Zfp106 UTSW 2 120530490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGAGCAAAGGAAACCAC -3'
(R):5'- ATCTTGAACAGGAAGTGGCC -3'

Sequencing Primer
(F):5'- CCCCAGATACTCAGTCAAAATGAG -3'
(R):5'- AACAGGAAGTGGCCCCTCTG -3'
Posted On2014-07-14