Mutagenetix > Incidental Mutation

Incidental Mutation 'R1932:Manba'

215447

Institutional Source

Beutler Lab

Gene Symbol

Manba

Ensembl Gene

ENSMUSG00000028164

Gene Name

mannosidase, beta A, lysosomal

Synonyms

B930014J03Rik, Bmn, 2410030O07Rik

MMRRC Submission

039950-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R1932 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135485611-135571404 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135544740 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 376 (F376S)

Ref Sequence

ENSEMBL: ENSMUSP00000029814 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029814] [ENSMUST00000131610]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000029814
AA Change: F376S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000029814
Gene: ENSMUSG00000028164
AA Change: F376S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Glyco_hydro_2_N	42	211	6.5e-11	PFAM
Pfam:Glyco_hydro_2_C	340	595	3.8e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123061

Predicted Effect

probably benign
Transcript: ENSMUST00000131610

SMART Domains

Protein: ENSMUSP00000122148
Gene: ENSMUSG00000028164

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Glyco_hydro_2_N	22	163	1.8e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140496

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140893

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147872

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation results in no dysmorphology or overt neurological problems. Homozygotes show no beta-mannosidase activity and display consistent cytoplasmic vacuolation in the central nervous system and minimal vacuolation in most visceral organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	A	9: 44,279,394	Q278H	probably benign	Het
Ace3	T	C	11: 106,004,610		probably null	Het
Aco1	T	C	4: 40,176,499	V221A	probably damaging	Het
Adamts20	T	A	15: 94,404,010	H27L	probably benign	Het
Adamts8	A	G	9: 30,956,512	D544G	probably benign	Het
Angptl4	C	A	17: 33,781,275	E40*	probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atf7ip2	T	A	16: 10,241,703	I369N	possibly damaging	Het
Atp6ap1l	T	A	13: 90,883,687	Y292F	probably damaging	Het
Atp6v1b2	A	T	8: 69,102,807	K217*	probably null	Het
Bid	C	T	6: 120,897,255	A110T	possibly damaging	Het
Blvra	T	A	2: 127,095,148	W174R	probably damaging	Het
Catsperg1	C	T	7: 29,198,143	G239R	probably damaging	Het
Ccdc157	G	T	11: 4,146,549	A400D	probably damaging	Het
Chd2	G	T	7: 73,454,445	P1298T	probably damaging	Het
CK137956	G	A	4: 127,946,858	L352F	possibly damaging	Het
Col22a1	G	A	15: 71,870,140	P503S	unknown	Het
Cox15	C	T	19: 43,746,785	R181H	probably benign	Het
Crem	C	T	18: 3,299,284	G47R	probably benign	Het
Crygs	T	A	16: 22,806,554	T46S	probably benign	Het
Cts8	T	A	13: 61,253,615	H62L	probably damaging	Het
Cyp4a32	T	A	4: 115,611,277	F319I	possibly damaging	Het
Dchs1	T	C	7: 105,765,902	S692G	probably damaging	Het
Ddx23	G	A	15: 98,650,718	R370W	possibly damaging	Het
Defa29	A	T	8: 21,326,849	S43T	probably damaging	Het
Dnajc14	A	G	10: 128,816,792	D573G	probably damaging	Het
Drd5	A	G	5: 38,319,976	Y104C	probably benign	Het
Efcab7	C	T	4: 99,911,018	P102L	probably damaging	Het
Efhc1	A	G	1: 20,967,400	Y267C	probably damaging	Het
Eif2ak4	T	C	2: 118,448,486	Y243H	probably damaging	Het
Gfm2	T	A	13: 97,141,967	I7N	probably damaging	Het
Gmds	A	G	13: 32,127,997	F150L	possibly damaging	Het
Gp2	T	C	7: 119,454,232	T169A	possibly damaging	Het
Grb14	A	G	2: 64,912,802	F508L	probably damaging	Het
Hdac5	T	A	11: 102,195,872		probably benign	Het
Heatr1	T	A	13: 12,435,185	M620K	probably damaging	Het
Herc3	A	G	6: 58,876,793	E608G	probably damaging	Het
Hoxb4	T	C	11: 96,320,041	Y156H	probably damaging	Het
Ifi205	T	A	1: 174,028,414	I17F	possibly damaging	Het
Il2rb	A	T	15: 78,491,777	S25T	possibly damaging	Het
Kansl1	T	C	11: 104,335,097	T998A	probably damaging	Het
Kcna6	G	T	6: 126,738,488	H479Q	probably benign	Het
Kif2a	T	C	13: 106,978,091	K350R	probably benign	Het
Lct	G	T	1: 128,294,161	A1547E	probably damaging	Het
Lhx9	T	A	1: 138,842,009		probably benign	Het
Lingo1	T	A	9: 56,619,650	I552F	possibly damaging	Het
Lrp4	G	A	2: 91,497,355	W1516*	probably null	Het
Lrp5	C	T	19: 3,610,131	V978I	probably benign	Het
Ltbp1	T	A	17: 75,313,034	D719E	probably benign	Het
Ltbp4	A	G	7: 27,307,766		probably null	Het
Macf1	A	G	4: 123,452,037	I1326T	probably damaging	Het
Mink1	T	C	11: 70,608,428		probably null	Het
Nfatc2ip	C	T	7: 126,384,992	V410I	probably damaging	Het
Nlrp1b	A	T	11: 71,182,138	I293N	probably damaging	Het
Olfr432	T	C	1: 174,050,678	Y102H	probably damaging	Het
Otol1	A	C	3: 70,028,104	E476D	probably benign	Het
Pcdhb4	C	T	18: 37,309,541	P635S	probably benign	Het
Pfkfb4	T	A	9: 108,999,169	F91I	probably damaging	Het
Polq	G	A	16: 37,062,304	R1610Q	possibly damaging	Het
Polr3c	A	T	3: 96,719,298	L270H	probably damaging	Het
Ppp1r15b	C	T	1: 133,131,625		probably benign	Het
Prkca	T	G	11: 108,192,149	D90A	probably benign	Het
Sall3	T	C	18: 80,969,753	D1156G	probably benign	Het
Scn7a	A	T	2: 66,676,102	L1481H	probably damaging	Het
Selenon	A	T	4: 134,544,618	I292N	probably damaging	Het
Sema6d	T	A	2: 124,659,886		probably null	Het
Sgpp1	G	T	12: 75,716,179	Y409*	probably null	Het
Sh3pxd2a	A	G	19: 47,267,508	S924P	probably benign	Het
Slc25a13	A	G	6: 6,042,264	V638A	probably benign	Het
Snhg11	T	C	2: 158,376,826		probably benign	Het
Sorbs2	A	G	8: 45,796,352	Q800R	probably benign	Het
Srf	C	A	17: 46,549,986	G401C	probably damaging	Het
Stradb	A	C	1: 58,991,105	N173H	probably benign	Het
Swap70	C	T	7: 110,279,263	A480V	possibly damaging	Het
Sycp2	A	G	2: 178,381,957	V422A	probably damaging	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tet3	T	C	6: 83,404,379	N269S	possibly damaging	Het
Thap12	A	T	7: 98,716,838	I738F	possibly damaging	Het
Tiam2	C	T	17: 3,514,725	R1413C	possibly damaging	Het
Tmem229a	A	T	6: 24,955,011	F248Y	probably damaging	Het
Tmprss7	G	A	16: 45,684,593	Q145*	probably null	Het
Tnc	A	T	4: 63,993,025		probably null	Het
Tonsl	A	T	15: 76,624,597	Y21N	probably damaging	Het
Tpr	A	G	1: 150,421,663	D1009G	probably benign	Het
Trpm2	G	A	10: 77,941,158	A435V	probably damaging	Het
Ubr3	T	A	2: 69,953,476		probably null	Het
Vcan	T	C	13: 89,705,534	N436D	possibly damaging	Het
Vmn2r104	T	A	17: 20,040,769	Y464F	probably damaging	Het
Vmn2r44	T	A	7: 8,367,982	R688S	probably benign	Het
Wdr74	G	T	19: 8,737,947	V157L	probably benign	Het
Wnt7a	T	A	6: 91,394,548	D144V	probably benign	Het
Zfp106	C	T	2: 120,531,681	A986T	possibly damaging	Het

Other mutations in Manba

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01374:Manba	APN	3	135554780	nonsense	probably null
IGL01443:Manba	APN	3	135544828	missense	probably damaging	1.00
IGL01796:Manba	APN	3	135542389	missense	probably damaging	1.00
IGL02396:Manba	APN	3	135544764	missense	probably damaging	1.00
IGL02471:Manba	APN	3	135507008	splice site	probably benign
IGL02809:Manba	APN	3	135547560	missense	probably damaging	1.00
IGL02861:Manba	APN	3	135570263	missense	probably benign	0.03
IGL02934:Manba	APN	3	135544749	missense	probably benign	0.00
IGL03130:Manba	APN	3	135551159	missense	probably damaging	1.00
IGL03237:Manba	APN	3	135544751	missense	probably damaging	1.00
IGL03342:Manba	APN	3	135517987	missense	possibly damaging	0.51
R0551:Manba	UTSW	3	135517973	missense	probably damaging	0.98
R1549:Manba	UTSW	3	135544806	missense	probably damaging	1.00
R1752:Manba	UTSW	3	135506945	missense	probably damaging	1.00
R1991:Manba	UTSW	3	135551191	missense	probably benign	0.05
R3729:Manba	UTSW	3	135554850	missense	probably benign	0.00
R3731:Manba	UTSW	3	135554850	missense	probably benign	0.00
R3813:Manba	UTSW	3	135563262	missense	possibly damaging	0.67
R4712:Manba	UTSW	3	135544814	missense	probably damaging	1.00
R5001:Manba	UTSW	3	135567630	missense	probably benign	0.00
R5481:Manba	UTSW	3	135524556	missense	possibly damaging	0.86
R5889:Manba	UTSW	3	135524598	nonsense	probably null
R6033:Manba	UTSW	3	135549261	missense	probably benign	0.00
R6033:Manba	UTSW	3	135549261	missense	probably benign	0.00
R6434:Manba	UTSW	3	135511973	splice site	probably null
R6760:Manba	UTSW	3	135542451	missense	probably damaging	0.98
R7164:Manba	UTSW	3	135542388	missense	probably damaging	1.00
R7182:Manba	UTSW	3	135567513	missense	probably benign	0.06
R7184:Manba	UTSW	3	135523154	missense	possibly damaging	0.62
R7212:Manba	UTSW	3	135567635	missense	probably benign
R7266:Manba	UTSW	3	135517912	missense	probably damaging	1.00
R7271:Manba	UTSW	3	135542376	missense	probably damaging	1.00
R7466:Manba	UTSW	3	135542393	missense	probably benign	0.13
R7467:Manba	UTSW	3	135544801	missense	probably damaging	1.00
R7542:Manba	UTSW	3	135566593	missense	probably benign	0.10
R7546:Manba	UTSW	3	135570246	missense	probably benign	0.01
R7726:Manba	UTSW	3	135518009	missense	probably benign	0.14
R8475:Manba	UTSW	3	135511812	missense	probably benign	0.13
R8768:Manba	UTSW	3	135551234	missense	probably damaging	1.00
R8856:Manba	UTSW	3	135518003	missense	probably damaging	0.98
R9140:Manba	UTSW	3	135485729	missense	probably benign
R9449:Manba	UTSW	3	135549318	missense	probably benign	0.01
Z1176:Manba	UTSW	3	135563274	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTGTTGATTGGAGCAAAATC -3'
(R):5'- ATGACTCCCTGCTCTGAGAG -3'

Sequencing Primer
(F):5'- gttcgttcgttcgttcgt -3'
(R):5'- ACTCCCTGCTCTGAGAGAGGTG -3'

Posted On

2014-07-14