Incidental Mutation 'R1932:Drd5'
ID 215455
Institutional Source Beutler Lab
Gene Symbol Drd5
Ensembl Gene ENSMUSG00000039358
Gene Name dopamine receptor D5
Synonyms D5R, Gpcr1, Drd1b, Drd-5, DRD1b
MMRRC Submission 039950-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R1932 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 38319367-38322518 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 38319976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 104 (Y104C)
Ref Sequence ENSEMBL: ENSMUSP00000039691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041646]
AlphaFold Q8BLD9
Predicted Effect probably benign
Transcript: ENSMUST00000041646
AA Change: Y104C

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039691
Gene: ENSMUSG00000039358
AA Change: Y104C

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 47 177 5.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 49 179 1e-7 PFAM
Pfam:7tm_1 55 354 1.5e-74 PFAM
Pfam:7TM_GPCR_Srsx 210 368 2.4e-6 PFAM
low complexity region 419 430 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181240
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D5 subtype of the dopamine receptor. The D5 subtype is a G-protein coupled receptor which stimulates adenylyl cyclase. This receptor is expressed in neurons in the limbic regions of the brain. It has a 10-fold higher affinity for dopamine than the D1 subtype. Pseudogenes related to this gene reside on chromosomes 1 and 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice develop hypertension and exhibit elevated blood pressure caused by increased sympathetic tone. Mice homozygous for another knock-out allele exhibit increased methamphetamine-induced ambulatory activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,279,394 Q278H probably benign Het
Ace3 T C 11: 106,004,610 probably null Het
Aco1 T C 4: 40,176,499 V221A probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamts8 A G 9: 30,956,512 D544G probably benign Het
Angptl4 C A 17: 33,781,275 E40* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip2 T A 16: 10,241,703 I369N possibly damaging Het
Atp6ap1l T A 13: 90,883,687 Y292F probably damaging Het
Atp6v1b2 A T 8: 69,102,807 K217* probably null Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Blvra T A 2: 127,095,148 W174R probably damaging Het
Catsperg1 C T 7: 29,198,143 G239R probably damaging Het
Ccdc157 G T 11: 4,146,549 A400D probably damaging Het
Chd2 G T 7: 73,454,445 P1298T probably damaging Het
CK137956 G A 4: 127,946,858 L352F possibly damaging Het
Col22a1 G A 15: 71,870,140 P503S unknown Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Crem C T 18: 3,299,284 G47R probably benign Het
Crygs T A 16: 22,806,554 T46S probably benign Het
Cts8 T A 13: 61,253,615 H62L probably damaging Het
Cyp4a32 T A 4: 115,611,277 F319I possibly damaging Het
Dchs1 T C 7: 105,765,902 S692G probably damaging Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Defa29 A T 8: 21,326,849 S43T probably damaging Het
Dnajc14 A G 10: 128,816,792 D573G probably damaging Het
Efcab7 C T 4: 99,911,018 P102L probably damaging Het
Efhc1 A G 1: 20,967,400 Y267C probably damaging Het
Eif2ak4 T C 2: 118,448,486 Y243H probably damaging Het
Gfm2 T A 13: 97,141,967 I7N probably damaging Het
Gmds A G 13: 32,127,997 F150L possibly damaging Het
Gp2 T C 7: 119,454,232 T169A possibly damaging Het
Grb14 A G 2: 64,912,802 F508L probably damaging Het
Hdac5 T A 11: 102,195,872 probably benign Het
Heatr1 T A 13: 12,435,185 M620K probably damaging Het
Herc3 A G 6: 58,876,793 E608G probably damaging Het
Hoxb4 T C 11: 96,320,041 Y156H probably damaging Het
Ifi205 T A 1: 174,028,414 I17F possibly damaging Het
Il2rb A T 15: 78,491,777 S25T possibly damaging Het
Kansl1 T C 11: 104,335,097 T998A probably damaging Het
Kcna6 G T 6: 126,738,488 H479Q probably benign Het
Kif2a T C 13: 106,978,091 K350R probably benign Het
Lct G T 1: 128,294,161 A1547E probably damaging Het
Lhx9 T A 1: 138,842,009 probably benign Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Lrp4 G A 2: 91,497,355 W1516* probably null Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Ltbp1 T A 17: 75,313,034 D719E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Macf1 A G 4: 123,452,037 I1326T probably damaging Het
Manba T C 3: 135,544,740 F376S probably benign Het
Mink1 T C 11: 70,608,428 probably null Het
Nfatc2ip C T 7: 126,384,992 V410I probably damaging Het
Nlrp1b A T 11: 71,182,138 I293N probably damaging Het
Olfr432 T C 1: 174,050,678 Y102H probably damaging Het
Otol1 A C 3: 70,028,104 E476D probably benign Het
Pcdhb4 C T 18: 37,309,541 P635S probably benign Het
Pfkfb4 T A 9: 108,999,169 F91I probably damaging Het
Polq G A 16: 37,062,304 R1610Q possibly damaging Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Ppp1r15b C T 1: 133,131,625 probably benign Het
Prkca T G 11: 108,192,149 D90A probably benign Het
Sall3 T C 18: 80,969,753 D1156G probably benign Het
Scn7a A T 2: 66,676,102 L1481H probably damaging Het
Selenon A T 4: 134,544,618 I292N probably damaging Het
Sema6d T A 2: 124,659,886 probably null Het
Sgpp1 G T 12: 75,716,179 Y409* probably null Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc25a13 A G 6: 6,042,264 V638A probably benign Het
Snhg11 T C 2: 158,376,826 probably benign Het
Sorbs2 A G 8: 45,796,352 Q800R probably benign Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Swap70 C T 7: 110,279,263 A480V possibly damaging Het
Sycp2 A G 2: 178,381,957 V422A probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet3 T C 6: 83,404,379 N269S possibly damaging Het
Thap12 A T 7: 98,716,838 I738F possibly damaging Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmem229a A T 6: 24,955,011 F248Y probably damaging Het
Tmprss7 G A 16: 45,684,593 Q145* probably null Het
Tnc A T 4: 63,993,025 probably null Het
Tonsl A T 15: 76,624,597 Y21N probably damaging Het
Tpr A G 1: 150,421,663 D1009G probably benign Het
Trpm2 G A 10: 77,941,158 A435V probably damaging Het
Ubr3 T A 2: 69,953,476 probably null Het
Vcan T C 13: 89,705,534 N436D possibly damaging Het
Vmn2r104 T A 17: 20,040,769 Y464F probably damaging Het
Vmn2r44 T A 7: 8,367,982 R688S probably benign Het
Wdr74 G T 19: 8,737,947 V157L probably benign Het
Wnt7a T A 6: 91,394,548 D144V probably benign Het
Zfp106 C T 2: 120,531,681 A986T possibly damaging Het
Other mutations in Drd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Drd5 APN 5 38319781 missense probably benign 0.25
PIT4305001:Drd5 UTSW 5 38320584 missense probably damaging 1.00
R0051:Drd5 UTSW 5 38320614 missense probably benign 0.39
R0051:Drd5 UTSW 5 38320614 missense probably benign 0.39
R0571:Drd5 UTSW 5 38319927 missense probably damaging 1.00
R1507:Drd5 UTSW 5 38320722 missense probably damaging 1.00
R1663:Drd5 UTSW 5 38320855 missense probably benign 0.02
R1777:Drd5 UTSW 5 38320161 missense probably damaging 1.00
R1986:Drd5 UTSW 5 38320113 missense probably damaging 0.99
R2047:Drd5 UTSW 5 38320336 missense probably damaging 1.00
R3875:Drd5 UTSW 5 38319814 missense possibly damaging 0.84
R5033:Drd5 UTSW 5 38320201 missense probably damaging 1.00
R5201:Drd5 UTSW 5 38320023 missense probably damaging 0.96
R5255:Drd5 UTSW 5 38319967 missense probably damaging 1.00
R5393:Drd5 UTSW 5 38320905 missense probably benign
R5639:Drd5 UTSW 5 38319835 missense possibly damaging 0.81
R7241:Drd5 UTSW 5 38320536 missense probably damaging 1.00
R7520:Drd5 UTSW 5 38320852 missense probably benign 0.00
R7739:Drd5 UTSW 5 38320078 missense probably damaging 1.00
R8300:Drd5 UTSW 5 38320329 missense probably damaging 0.99
R8746:Drd5 UTSW 5 38320090 missense probably benign 0.04
R8829:Drd5 UTSW 5 38319735 missense probably benign 0.08
R8832:Drd5 UTSW 5 38319735 missense probably benign 0.08
R8870:Drd5 UTSW 5 38320404 missense possibly damaging 0.76
R9600:Drd5 UTSW 5 38320831 missense possibly damaging 0.79
R9705:Drd5 UTSW 5 38320684 missense probably damaging 1.00
R9717:Drd5 UTSW 5 38320747 missense probably damaging 1.00
Z1177:Drd5 UTSW 5 38320386 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TAATCGTCTGGACCTTGCTCG -3'
(R):5'- CCTTGTCTCTGTGCCAATTGAG -3'

Sequencing Primer
(F):5'- GGCAACGTCCTAGTGTGTGC -3'
(R):5'- ACAAGGTCCAGGCCAGG -3'
Posted On 2014-07-14