Mutagenetix > Incidental Mutation

Incidental Mutation 'R1932:Slc25a13'

215457

Institutional Source

Beutler Lab

Gene Symbol

Slc25a13

Ensembl Gene

ENSMUSG00000015112

Gene Name

solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13

Synonyms

citrin, Ctrn

MMRRC Submission

039950-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.341) question?

Stock #

R1932 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6041218-6217173 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6042264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 638 (V638A)

Ref Sequence

ENSEMBL: ENSMUSP00000139571 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015256] [ENSMUST00000188414]

AlphaFold

Q9QXX4

Predicted Effect

probably benign
Transcript: ENSMUST00000015256
AA Change: V638A

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000015256
Gene: ENSMUSG00000015112
AA Change: V638A

Domain	Start	End	E-Value	Type
EFh	57	85	5.75e1	SMART
EFh	91	119	6.14e-1	SMART
EFh	162	190	7.87e1	SMART
Pfam:Mito_carr	327	424	5.2e-27	PFAM
Pfam:Mito_carr	425	516	1.2e-17	PFAM
Pfam:Mito_carr	517	612	1.3e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000188414
AA Change: V638A

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000139571
Gene: ENSMUSG00000015112
AA Change: V638A

Domain	Start	End	E-Value	Type
EFh	57	85	5.75e1	SMART
EFh	91	119	6.14e-1	SMART
EFh	162	190	7.87e1	SMART
Pfam:Mito_carr	327	424	2.6e-26	PFAM
Pfam:Mito_carr	425	516	4.4e-19	PFAM
Pfam:Mito_carr	517	612	1.4e-29	PFAM

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the mitochondrial carrier family. The encoded protein contains four EF-hand Ca(2+) binding motifs in the N-terminal domain, and localizes to mitochondria. The protein catalyzes the exchange of aspartate for glutamate and a proton across the inner mitochondrial membrane, and is stimulated by calcium on the external side of the inner mitochondrial membrane. Mutations in this gene result in citrullinemia, type II. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene appear normal, healthy and fertile, although they have a number of metabolic defects, but the spontaneous hyperspin deletion spanning from intron 3 to exon 17 also eliminates a modifier of Dlx5 causing a recessive vestibular and mortality phenotype [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	A	9: 44,279,394	Q278H	probably benign	Het
Ace3	T	C	11: 106,004,610		probably null	Het
Aco1	T	C	4: 40,176,499	V221A	probably damaging	Het
Adamts20	T	A	15: 94,404,010	H27L	probably benign	Het
Adamts8	A	G	9: 30,956,512	D544G	probably benign	Het
Angptl4	C	A	17: 33,781,275	E40*	probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atf7ip2	T	A	16: 10,241,703	I369N	possibly damaging	Het
Atp6ap1l	T	A	13: 90,883,687	Y292F	probably damaging	Het
Atp6v1b2	A	T	8: 69,102,807	K217*	probably null	Het
Bid	C	T	6: 120,897,255	A110T	possibly damaging	Het
Blvra	T	A	2: 127,095,148	W174R	probably damaging	Het
Catsperg1	C	T	7: 29,198,143	G239R	probably damaging	Het
Ccdc157	G	T	11: 4,146,549	A400D	probably damaging	Het
Chd2	G	T	7: 73,454,445	P1298T	probably damaging	Het
CK137956	G	A	4: 127,946,858	L352F	possibly damaging	Het
Col22a1	G	A	15: 71,870,140	P503S	unknown	Het
Cox15	C	T	19: 43,746,785	R181H	probably benign	Het
Crem	C	T	18: 3,299,284	G47R	probably benign	Het
Crygs	T	A	16: 22,806,554	T46S	probably benign	Het
Cts8	T	A	13: 61,253,615	H62L	probably damaging	Het
Cyp4a32	T	A	4: 115,611,277	F319I	possibly damaging	Het
Dchs1	T	C	7: 105,765,902	S692G	probably damaging	Het
Ddx23	G	A	15: 98,650,718	R370W	possibly damaging	Het
Defa29	A	T	8: 21,326,849	S43T	probably damaging	Het
Dnajc14	A	G	10: 128,816,792	D573G	probably damaging	Het
Drd5	A	G	5: 38,319,976	Y104C	probably benign	Het
Efcab7	C	T	4: 99,911,018	P102L	probably damaging	Het
Efhc1	A	G	1: 20,967,400	Y267C	probably damaging	Het
Eif2ak4	T	C	2: 118,448,486	Y243H	probably damaging	Het
Gfm2	T	A	13: 97,141,967	I7N	probably damaging	Het
Gmds	A	G	13: 32,127,997	F150L	possibly damaging	Het
Gp2	T	C	7: 119,454,232	T169A	possibly damaging	Het
Grb14	A	G	2: 64,912,802	F508L	probably damaging	Het
Hdac5	T	A	11: 102,195,872		probably benign	Het
Heatr1	T	A	13: 12,435,185	M620K	probably damaging	Het
Herc3	A	G	6: 58,876,793	E608G	probably damaging	Het
Hoxb4	T	C	11: 96,320,041	Y156H	probably damaging	Het
Ifi205	T	A	1: 174,028,414	I17F	possibly damaging	Het
Il2rb	A	T	15: 78,491,777	S25T	possibly damaging	Het
Kansl1	T	C	11: 104,335,097	T998A	probably damaging	Het
Kcna6	G	T	6: 126,738,488	H479Q	probably benign	Het
Kif2a	T	C	13: 106,978,091	K350R	probably benign	Het
Lct	G	T	1: 128,294,161	A1547E	probably damaging	Het
Lhx9	T	A	1: 138,842,009		probably benign	Het
Lingo1	T	A	9: 56,619,650	I552F	possibly damaging	Het
Lrp4	G	A	2: 91,497,355	W1516*	probably null	Het
Lrp5	C	T	19: 3,610,131	V978I	probably benign	Het
Ltbp1	T	A	17: 75,313,034	D719E	probably benign	Het
Ltbp4	A	G	7: 27,307,766		probably null	Het
Macf1	A	G	4: 123,452,037	I1326T	probably damaging	Het
Manba	T	C	3: 135,544,740	F376S	probably benign	Het
Mink1	T	C	11: 70,608,428		probably null	Het
Nfatc2ip	C	T	7: 126,384,992	V410I	probably damaging	Het
Nlrp1b	A	T	11: 71,182,138	I293N	probably damaging	Het
Olfr432	T	C	1: 174,050,678	Y102H	probably damaging	Het
Otol1	A	C	3: 70,028,104	E476D	probably benign	Het
Pcdhb4	C	T	18: 37,309,541	P635S	probably benign	Het
Pfkfb4	T	A	9: 108,999,169	F91I	probably damaging	Het
Polq	G	A	16: 37,062,304	R1610Q	possibly damaging	Het
Polr3c	A	T	3: 96,719,298	L270H	probably damaging	Het
Ppp1r15b	C	T	1: 133,131,625		probably benign	Het
Prkca	T	G	11: 108,192,149	D90A	probably benign	Het
Sall3	T	C	18: 80,969,753	D1156G	probably benign	Het
Scn7a	A	T	2: 66,676,102	L1481H	probably damaging	Het
Selenon	A	T	4: 134,544,618	I292N	probably damaging	Het
Sema6d	T	A	2: 124,659,886		probably null	Het
Sgpp1	G	T	12: 75,716,179	Y409*	probably null	Het
Sh3pxd2a	A	G	19: 47,267,508	S924P	probably benign	Het
Snhg11	T	C	2: 158,376,826		probably benign	Het
Sorbs2	A	G	8: 45,796,352	Q800R	probably benign	Het
Srf	C	A	17: 46,549,986	G401C	probably damaging	Het
Stradb	A	C	1: 58,991,105	N173H	probably benign	Het
Swap70	C	T	7: 110,279,263	A480V	possibly damaging	Het
Sycp2	A	G	2: 178,381,957	V422A	probably damaging	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tet3	T	C	6: 83,404,379	N269S	possibly damaging	Het
Thap12	A	T	7: 98,716,838	I738F	possibly damaging	Het
Tiam2	C	T	17: 3,514,725	R1413C	possibly damaging	Het
Tmem229a	A	T	6: 24,955,011	F248Y	probably damaging	Het
Tmprss7	G	A	16: 45,684,593	Q145*	probably null	Het
Tnc	A	T	4: 63,993,025		probably null	Het
Tonsl	A	T	15: 76,624,597	Y21N	probably damaging	Het
Tpr	A	G	1: 150,421,663	D1009G	probably benign	Het
Trpm2	G	A	10: 77,941,158	A435V	probably damaging	Het
Ubr3	T	A	2: 69,953,476		probably null	Het
Vcan	T	C	13: 89,705,534	N436D	possibly damaging	Het
Vmn2r104	T	A	17: 20,040,769	Y464F	probably damaging	Het
Vmn2r44	T	A	7: 8,367,982	R688S	probably benign	Het
Wdr74	G	T	19: 8,737,947	V157L	probably benign	Het
Wnt7a	T	A	6: 91,394,548	D144V	probably benign	Het
Zfp106	C	T	2: 120,531,681	A986T	possibly damaging	Het

Other mutations in Slc25a13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Slc25a13	APN	6	6042739	critical splice donor site	probably null
IGL02237:Slc25a13	APN	6	6042646	missense	probably damaging	1.00
IGL02285:Slc25a13	APN	6	6042643	missense	possibly damaging	0.95
IGL02287:Slc25a13	APN	6	6216992	splice site	probably benign
IGL02593:Slc25a13	APN	6	6042265	missense	probably benign	0.00
R0028:Slc25a13	UTSW	6	6181047	missense	probably benign	0.10
R0045:Slc25a13	UTSW	6	6109277	missense	probably benign	0.05
R0384:Slc25a13	UTSW	6	6042600	nonsense	probably null
R0711:Slc25a13	UTSW	6	6117128	missense	probably damaging	0.99
R1299:Slc25a13	UTSW	6	6113937	critical splice donor site	probably null
R1625:Slc25a13	UTSW	6	6096675	missense	probably damaging	1.00
R1701:Slc25a13	UTSW	6	6152525	critical splice acceptor site	probably null
R1792:Slc25a13	UTSW	6	6115104	missense	possibly damaging	0.79
R1933:Slc25a13	UTSW	6	6109262	missense	probably damaging	1.00
R1952:Slc25a13	UTSW	6	6152482	missense	probably damaging	1.00
R1969:Slc25a13	UTSW	6	6096668	critical splice donor site	probably null
R2027:Slc25a13	UTSW	6	6073487	missense	probably damaging	1.00
R2074:Slc25a13	UTSW	6	6114017	missense	probably benign	0.21
R2432:Slc25a13	UTSW	6	6114017	missense	probably benign	0.21
R2508:Slc25a13	UTSW	6	6117190	missense	probably benign	0.06
R3774:Slc25a13	UTSW	6	6109288	missense	probably damaging	1.00
R3775:Slc25a13	UTSW	6	6109288	missense	probably damaging	1.00
R4804:Slc25a13	UTSW	6	6109213	missense	probably damaging	1.00
R4816:Slc25a13	UTSW	6	6114274	missense	possibly damaging	0.71
R4978:Slc25a13	UTSW	6	6042300	missense	probably damaging	0.97
R6529:Slc25a13	UTSW	6	6073451	missense	probably benign	0.39
R6615:Slc25a13	UTSW	6	6073454	missense	probably damaging	1.00
R6709:Slc25a13	UTSW	6	6073440	missense	possibly damaging	0.88
R7346:Slc25a13	UTSW	6	6181100	missense	possibly damaging	0.67
R7571:Slc25a13	UTSW	6	6052785	missense	probably damaging	1.00
R7807:Slc25a13	UTSW	6	6117164	missense	probably damaging	0.99
R7852:Slc25a13	UTSW	6	6152461	missense	probably damaging	0.96
R8460:Slc25a13	UTSW	6	6073513	missense	probably damaging	1.00
R8710:Slc25a13	UTSW	6	6114238	missense	probably benign	0.21
R9128:Slc25a13	UTSW	6	6109987	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- GAGGCTTATTGTGGTTCCAATC -3'
(R):5'- TTCTCATTGAGAAGTGCAGGGG -3'

Sequencing Primer
(F):5'- TCATTTTACAGGCACATCCAGG -3'
(R):5'- TGTGACAACGTCCACAAGGTC -3'

Posted On

2014-07-14