Incidental Mutation 'R1932:Tet3'
ID 215460
Institutional Source Beutler Lab
Gene Symbol Tet3
Ensembl Gene ENSMUSG00000034832
Gene Name tet methylcytosine dioxygenase 3
Synonyms B430006D22Rik, D230004J03Rik
MMRRC Submission 039950-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.640) question?
Stock # R1932 (G1)
Quality Score 197
Status Not validated
Chromosome 6
Chromosomal Location 83339355-83434190 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83381361 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 269 (N269S)
Ref Sequence ENSEMBL: ENSMUSP00000139630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089622] [ENSMUST00000186548] [ENSMUST00000190295]
AlphaFold Q8BG87
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056191
Predicted Effect probably benign
Transcript: ENSMUST00000089622
AA Change: N134S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087049
Gene: ENSMUSG00000034832
AA Change: N134S

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
low complexity region 115 126 N/A INTRINSIC
internal_repeat_1 160 277 4.9e-5 PROSPERO
low complexity region 279 297 N/A INTRINSIC
low complexity region 359 371 N/A INTRINSIC
low complexity region 418 456 N/A INTRINSIC
Tet_JBP 858 1570 N/A SMART
coiled coil region 1579 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184003
Predicted Effect possibly damaging
Transcript: ENSMUST00000186548
AA Change: N269S

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139630
Gene: ENSMUSG00000034832
AA Change: N269S

DomainStartEndE-ValueType
Pfam:zf-CXXC 49 89 8e-6 PFAM
low complexity region 162 173 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
internal_repeat_1 295 412 5.5e-5 PROSPERO
low complexity region 414 432 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
low complexity region 553 591 N/A INTRINSIC
Tet_JBP 993 1705 N/A SMART
coiled coil region 1714 1738 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190295
SMART Domains Protein: ENSMUSP00000139679
Gene: ENSMUSG00000034832

DomainStartEndE-ValueType
low complexity region 72 83 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the ten-eleven translocation (TET) gene family, including TET3, play a role in the DNA methylation process (Langemeijer et al., 2009 [PubMed 19923888]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice inheriting a null allele from a germ cell conditional null mother display impaired reprogramming of the paternal genome resulting in reduced embryo viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,190,691 (GRCm39) Q278H probably benign Het
Ace3 T C 11: 105,895,436 (GRCm39) probably null Het
Aco1 T C 4: 40,176,499 (GRCm39) V221A probably damaging Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamts8 A G 9: 30,867,808 (GRCm39) D544G probably benign Het
Angptl4 C A 17: 34,000,249 (GRCm39) E40* probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atf7ip2 T A 16: 10,059,567 (GRCm39) I369N possibly damaging Het
Atp6ap1l T A 13: 91,031,806 (GRCm39) Y292F probably damaging Het
Atp6v1b2 A T 8: 69,555,459 (GRCm39) K217* probably null Het
Bid C T 6: 120,874,216 (GRCm39) A110T possibly damaging Het
Blvra T A 2: 126,937,068 (GRCm39) W174R probably damaging Het
Catsperg1 C T 7: 28,897,568 (GRCm39) G239R probably damaging Het
Ccdc157 G T 11: 4,096,549 (GRCm39) A400D probably damaging Het
Chd2 G T 7: 73,104,193 (GRCm39) P1298T probably damaging Het
CK137956 G A 4: 127,840,651 (GRCm39) L352F possibly damaging Het
Col22a1 G A 15: 71,741,989 (GRCm39) P503S unknown Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Crem C T 18: 3,299,284 (GRCm39) G47R probably benign Het
Crygs T A 16: 22,625,304 (GRCm39) T46S probably benign Het
Cts8 T A 13: 61,401,429 (GRCm39) H62L probably damaging Het
Cyp4a32 T A 4: 115,468,474 (GRCm39) F319I possibly damaging Het
Dchs1 T C 7: 105,415,109 (GRCm39) S692G probably damaging Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Defa29 A T 8: 21,816,865 (GRCm39) S43T probably damaging Het
Dnajc14 A G 10: 128,652,661 (GRCm39) D573G probably damaging Het
Drd5 A G 5: 38,477,319 (GRCm39) Y104C probably benign Het
Efcab7 C T 4: 99,768,215 (GRCm39) P102L probably damaging Het
Efhc1 A G 1: 21,037,624 (GRCm39) Y267C probably damaging Het
Eif2ak4 T C 2: 118,278,967 (GRCm39) Y243H probably damaging Het
Gfm2 T A 13: 97,278,475 (GRCm39) I7N probably damaging Het
Gmds A G 13: 32,311,980 (GRCm39) F150L possibly damaging Het
Gp2 T C 7: 119,053,455 (GRCm39) T169A possibly damaging Het
Grb14 A G 2: 64,743,146 (GRCm39) F508L probably damaging Het
Hdac5 T A 11: 102,086,698 (GRCm39) probably benign Het
Heatr1 T A 13: 12,450,066 (GRCm39) M620K probably damaging Het
Herc3 A G 6: 58,853,778 (GRCm39) E608G probably damaging Het
Hoxb4 T C 11: 96,210,867 (GRCm39) Y156H probably damaging Het
Ifi205 T A 1: 173,855,980 (GRCm39) I17F possibly damaging Het
Il2rb A T 15: 78,375,977 (GRCm39) S25T possibly damaging Het
Kansl1 T C 11: 104,225,923 (GRCm39) T998A probably damaging Het
Kcna6 G T 6: 126,715,451 (GRCm39) H479Q probably benign Het
Kif2a T C 13: 107,114,599 (GRCm39) K350R probably benign Het
Lct G T 1: 128,221,898 (GRCm39) A1547E probably damaging Het
Lhx9 T A 1: 138,769,747 (GRCm39) probably benign Het
Lingo1 T A 9: 56,526,934 (GRCm39) I552F possibly damaging Het
Lrp4 G A 2: 91,327,700 (GRCm39) W1516* probably null Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Ltbp1 T A 17: 75,620,029 (GRCm39) D719E probably benign Het
Ltbp4 A G 7: 27,007,191 (GRCm39) probably null Het
Macf1 A G 4: 123,345,830 (GRCm39) I1326T probably damaging Het
Manba T C 3: 135,250,501 (GRCm39) F376S probably benign Het
Mink1 T C 11: 70,499,254 (GRCm39) probably null Het
Nfatc2ip C T 7: 125,984,164 (GRCm39) V410I probably damaging Het
Nlrp1b A T 11: 71,072,964 (GRCm39) I293N probably damaging Het
Or10aa3 T C 1: 173,878,244 (GRCm39) Y102H probably damaging Het
Otol1 A C 3: 69,935,437 (GRCm39) E476D probably benign Het
Pcdhb4 C T 18: 37,442,594 (GRCm39) P635S probably benign Het
Pfkfb4 T A 9: 108,828,237 (GRCm39) F91I probably damaging Het
Polq G A 16: 36,882,666 (GRCm39) R1610Q possibly damaging Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Ppp1r15b C T 1: 133,059,363 (GRCm39) probably benign Het
Prkca T G 11: 108,082,975 (GRCm39) D90A probably benign Het
Sall3 T C 18: 81,012,968 (GRCm39) D1156G probably benign Het
Scn7a A T 2: 66,506,446 (GRCm39) L1481H probably damaging Het
Selenon A T 4: 134,271,929 (GRCm39) I292N probably damaging Het
Sema6d T A 2: 124,501,806 (GRCm39) probably null Het
Sgpp1 G T 12: 75,762,953 (GRCm39) Y409* probably null Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc25a13 A G 6: 6,042,264 (GRCm39) V638A probably benign Het
Snhg11 T C 2: 158,218,746 (GRCm39) probably benign Het
Sorbs2 A G 8: 46,249,389 (GRCm39) Q800R probably benign Het
Srf C A 17: 46,860,912 (GRCm39) G401C probably damaging Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Swap70 C T 7: 109,878,470 (GRCm39) A480V possibly damaging Het
Sycp2 A G 2: 178,023,750 (GRCm39) V422A probably damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Thap12 A T 7: 98,366,045 (GRCm39) I738F possibly damaging Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmem229a A T 6: 24,955,010 (GRCm39) F248Y probably damaging Het
Tmprss7 G A 16: 45,504,956 (GRCm39) Q145* probably null Het
Tnc A T 4: 63,911,262 (GRCm39) probably null Het
Tonsl A T 15: 76,508,797 (GRCm39) Y21N probably damaging Het
Tpr A G 1: 150,297,414 (GRCm39) D1009G probably benign Het
Trpm2 G A 10: 77,776,992 (GRCm39) A435V probably damaging Het
Ubr3 T A 2: 69,783,820 (GRCm39) probably null Het
Vcan T C 13: 89,853,653 (GRCm39) N436D possibly damaging Het
Vmn2r104 T A 17: 20,261,031 (GRCm39) Y464F probably damaging Het
Vmn2r44 T A 7: 8,370,981 (GRCm39) R688S probably benign Het
Wdr74 G T 19: 8,715,311 (GRCm39) V157L probably benign Het
Wnt7a T A 6: 91,371,530 (GRCm39) D144V probably benign Het
Zfp106 C T 2: 120,362,162 (GRCm39) A986T possibly damaging Het
Other mutations in Tet3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Tet3 APN 6 83,345,637 (GRCm39) missense probably benign 0.06
IGL01396:Tet3 APN 6 83,346,620 (GRCm39) nonsense probably null
IGL02344:Tet3 APN 6 83,380,815 (GRCm39) missense probably benign 0.04
IGL02987:Tet3 APN 6 83,345,074 (GRCm39) missense probably damaging 0.99
IGL03126:Tet3 APN 6 83,353,769 (GRCm39) missense probably damaging 1.00
IGL03155:Tet3 APN 6 83,345,365 (GRCm39) missense probably damaging 1.00
IGL03286:Tet3 APN 6 83,352,760 (GRCm39) missense probably damaging 1.00
Reedy UTSW 6 83,345,066 (GRCm39) nonsense probably null
P0033:Tet3 UTSW 6 83,345,494 (GRCm39) missense probably damaging 1.00
R0131:Tet3 UTSW 6 83,345,770 (GRCm39) missense probably damaging 1.00
R0295:Tet3 UTSW 6 83,346,121 (GRCm39) missense probably benign 0.14
R0504:Tet3 UTSW 6 83,350,776 (GRCm39) missense probably damaging 1.00
R0524:Tet3 UTSW 6 83,356,924 (GRCm39) missense probably damaging 1.00
R1061:Tet3 UTSW 6 83,350,305 (GRCm39) missense probably damaging 0.99
R1160:Tet3 UTSW 6 83,381,434 (GRCm39) missense probably benign 0.00
R1550:Tet3 UTSW 6 83,363,010 (GRCm39) missense probably damaging 0.97
R1640:Tet3 UTSW 6 83,346,297 (GRCm39) missense probably benign 0.44
R1658:Tet3 UTSW 6 83,346,039 (GRCm39) missense probably benign 0.44
R1746:Tet3 UTSW 6 83,345,050 (GRCm39) missense probably damaging 1.00
R1761:Tet3 UTSW 6 83,380,641 (GRCm39) missense probably damaging 0.99
R1832:Tet3 UTSW 6 83,380,627 (GRCm39) missense probably benign
R1835:Tet3 UTSW 6 83,381,145 (GRCm39) missense possibly damaging 0.95
R2014:Tet3 UTSW 6 83,363,057 (GRCm39) missense probably damaging 1.00
R2230:Tet3 UTSW 6 83,346,453 (GRCm39) missense probably damaging 1.00
R2232:Tet3 UTSW 6 83,346,453 (GRCm39) missense probably damaging 1.00
R2922:Tet3 UTSW 6 83,345,494 (GRCm39) missense probably damaging 1.00
R3429:Tet3 UTSW 6 83,380,401 (GRCm39) missense probably damaging 1.00
R3430:Tet3 UTSW 6 83,380,401 (GRCm39) missense probably damaging 1.00
R4291:Tet3 UTSW 6 83,350,181 (GRCm39) missense probably damaging 1.00
R4349:Tet3 UTSW 6 83,380,257 (GRCm39) missense probably benign
R4809:Tet3 UTSW 6 83,379,928 (GRCm39) missense probably benign
R4846:Tet3 UTSW 6 83,353,865 (GRCm39) nonsense probably null
R5039:Tet3 UTSW 6 83,352,878 (GRCm39) missense probably damaging 1.00
R5233:Tet3 UTSW 6 83,363,045 (GRCm39) missense probably damaging 1.00
R5363:Tet3 UTSW 6 83,353,746 (GRCm39) critical splice donor site probably null
R5880:Tet3 UTSW 6 83,347,532 (GRCm39) missense probably damaging 1.00
R6270:Tet3 UTSW 6 83,352,773 (GRCm39) missense possibly damaging 0.86
R6277:Tet3 UTSW 6 83,345,066 (GRCm39) nonsense probably null
R6564:Tet3 UTSW 6 83,363,052 (GRCm39) missense possibly damaging 0.92
R6622:Tet3 UTSW 6 83,380,426 (GRCm39) missense probably benign 0.00
R7089:Tet3 UTSW 6 83,432,006 (GRCm39) missense possibly damaging 0.46
R7244:Tet3 UTSW 6 83,347,603 (GRCm39) missense probably damaging 1.00
R7251:Tet3 UTSW 6 83,381,038 (GRCm39) missense probably benign
R7361:Tet3 UTSW 6 83,345,076 (GRCm39) missense probably benign 0.15
R7436:Tet3 UTSW 6 83,345,211 (GRCm39) small insertion probably benign
R7438:Tet3 UTSW 6 83,345,211 (GRCm39) small insertion probably benign
R7544:Tet3 UTSW 6 83,381,623 (GRCm39) missense probably damaging 1.00
R7552:Tet3 UTSW 6 83,345,289 (GRCm39) missense probably damaging 1.00
R7942:Tet3 UTSW 6 83,353,956 (GRCm39) missense probably damaging 1.00
R8010:Tet3 UTSW 6 83,380,228 (GRCm39) missense unknown
R8063:Tet3 UTSW 6 83,379,723 (GRCm39) missense probably damaging 1.00
R8307:Tet3 UTSW 6 83,356,909 (GRCm39) missense probably damaging 1.00
R9016:Tet3 UTSW 6 83,345,253 (GRCm39) missense probably damaging 1.00
R9020:Tet3 UTSW 6 83,381,418 (GRCm39) missense probably damaging 1.00
R9377:Tet3 UTSW 6 83,380,596 (GRCm39) missense possibly damaging 0.95
R9476:Tet3 UTSW 6 83,381,808 (GRCm39) critical splice acceptor site probably null
R9476:Tet3 UTSW 6 83,380,935 (GRCm39) missense possibly damaging 0.91
R9510:Tet3 UTSW 6 83,381,808 (GRCm39) critical splice acceptor site probably null
R9510:Tet3 UTSW 6 83,380,935 (GRCm39) missense possibly damaging 0.91
R9582:Tet3 UTSW 6 83,381,226 (GRCm39) missense probably damaging 0.99
R9671:Tet3 UTSW 6 83,381,136 (GRCm39) missense possibly damaging 0.89
R9801:Tet3 UTSW 6 83,346,436 (GRCm39) missense possibly damaging 0.94
X0004:Tet3 UTSW 6 83,380,405 (GRCm39) missense probably benign 0.17
Z1176:Tet3 UTSW 6 83,436,003 (GRCm39) missense unknown
Z1176:Tet3 UTSW 6 83,381,332 (GRCm39) missense probably damaging 1.00
Z1176:Tet3 UTSW 6 83,347,680 (GRCm39) missense probably damaging 1.00
Z1177:Tet3 UTSW 6 83,381,276 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TTCCTTGGCAATGCTCAGCG -3'
(R):5'- CATCTTACGGGGCCCTTAGTAC -3'

Sequencing Primer
(F):5'- AATGCTCAGCGCGCTCTG -3'
(R):5'- TTAGTACCCGGCTCTATGAAAC -3'
Posted On 2014-07-14