Incidental Mutation 'R1932:Trpm2'
ID 215486
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms Trrp7, TRPC7, LTRPC2, 9830168K16Rik
MMRRC Submission 039950-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R1932 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 77743556-77805746 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 77776992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 435 (A435V)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably damaging
Transcript: ENSMUST00000105401
AA Change: A435V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: A435V

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,190,691 (GRCm39) Q278H probably benign Het
Ace3 T C 11: 105,895,436 (GRCm39) probably null Het
Aco1 T C 4: 40,176,499 (GRCm39) V221A probably damaging Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamts8 A G 9: 30,867,808 (GRCm39) D544G probably benign Het
Angptl4 C A 17: 34,000,249 (GRCm39) E40* probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atf7ip2 T A 16: 10,059,567 (GRCm39) I369N possibly damaging Het
Atp6ap1l T A 13: 91,031,806 (GRCm39) Y292F probably damaging Het
Atp6v1b2 A T 8: 69,555,459 (GRCm39) K217* probably null Het
Bid C T 6: 120,874,216 (GRCm39) A110T possibly damaging Het
Blvra T A 2: 126,937,068 (GRCm39) W174R probably damaging Het
Catsperg1 C T 7: 28,897,568 (GRCm39) G239R probably damaging Het
Ccdc157 G T 11: 4,096,549 (GRCm39) A400D probably damaging Het
Chd2 G T 7: 73,104,193 (GRCm39) P1298T probably damaging Het
CK137956 G A 4: 127,840,651 (GRCm39) L352F possibly damaging Het
Col22a1 G A 15: 71,741,989 (GRCm39) P503S unknown Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Crem C T 18: 3,299,284 (GRCm39) G47R probably benign Het
Crygs T A 16: 22,625,304 (GRCm39) T46S probably benign Het
Cts8 T A 13: 61,401,429 (GRCm39) H62L probably damaging Het
Cyp4a32 T A 4: 115,468,474 (GRCm39) F319I possibly damaging Het
Dchs1 T C 7: 105,415,109 (GRCm39) S692G probably damaging Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Defa29 A T 8: 21,816,865 (GRCm39) S43T probably damaging Het
Dnajc14 A G 10: 128,652,661 (GRCm39) D573G probably damaging Het
Drd5 A G 5: 38,477,319 (GRCm39) Y104C probably benign Het
Efcab7 C T 4: 99,768,215 (GRCm39) P102L probably damaging Het
Efhc1 A G 1: 21,037,624 (GRCm39) Y267C probably damaging Het
Eif2ak4 T C 2: 118,278,967 (GRCm39) Y243H probably damaging Het
Gfm2 T A 13: 97,278,475 (GRCm39) I7N probably damaging Het
Gmds A G 13: 32,311,980 (GRCm39) F150L possibly damaging Het
Gp2 T C 7: 119,053,455 (GRCm39) T169A possibly damaging Het
Grb14 A G 2: 64,743,146 (GRCm39) F508L probably damaging Het
Hdac5 T A 11: 102,086,698 (GRCm39) probably benign Het
Heatr1 T A 13: 12,450,066 (GRCm39) M620K probably damaging Het
Herc3 A G 6: 58,853,778 (GRCm39) E608G probably damaging Het
Hoxb4 T C 11: 96,210,867 (GRCm39) Y156H probably damaging Het
Ifi205 T A 1: 173,855,980 (GRCm39) I17F possibly damaging Het
Il2rb A T 15: 78,375,977 (GRCm39) S25T possibly damaging Het
Kansl1 T C 11: 104,225,923 (GRCm39) T998A probably damaging Het
Kcna6 G T 6: 126,715,451 (GRCm39) H479Q probably benign Het
Kif2a T C 13: 107,114,599 (GRCm39) K350R probably benign Het
Lct G T 1: 128,221,898 (GRCm39) A1547E probably damaging Het
Lhx9 T A 1: 138,769,747 (GRCm39) probably benign Het
Lingo1 T A 9: 56,526,934 (GRCm39) I552F possibly damaging Het
Lrp4 G A 2: 91,327,700 (GRCm39) W1516* probably null Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Ltbp1 T A 17: 75,620,029 (GRCm39) D719E probably benign Het
Ltbp4 A G 7: 27,007,191 (GRCm39) probably null Het
Macf1 A G 4: 123,345,830 (GRCm39) I1326T probably damaging Het
Manba T C 3: 135,250,501 (GRCm39) F376S probably benign Het
Mink1 T C 11: 70,499,254 (GRCm39) probably null Het
Nfatc2ip C T 7: 125,984,164 (GRCm39) V410I probably damaging Het
Nlrp1b A T 11: 71,072,964 (GRCm39) I293N probably damaging Het
Or10aa3 T C 1: 173,878,244 (GRCm39) Y102H probably damaging Het
Otol1 A C 3: 69,935,437 (GRCm39) E476D probably benign Het
Pcdhb4 C T 18: 37,442,594 (GRCm39) P635S probably benign Het
Pfkfb4 T A 9: 108,828,237 (GRCm39) F91I probably damaging Het
Polq G A 16: 36,882,666 (GRCm39) R1610Q possibly damaging Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Ppp1r15b C T 1: 133,059,363 (GRCm39) probably benign Het
Prkca T G 11: 108,082,975 (GRCm39) D90A probably benign Het
Sall3 T C 18: 81,012,968 (GRCm39) D1156G probably benign Het
Scn7a A T 2: 66,506,446 (GRCm39) L1481H probably damaging Het
Selenon A T 4: 134,271,929 (GRCm39) I292N probably damaging Het
Sema6d T A 2: 124,501,806 (GRCm39) probably null Het
Sgpp1 G T 12: 75,762,953 (GRCm39) Y409* probably null Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc25a13 A G 6: 6,042,264 (GRCm39) V638A probably benign Het
Snhg11 T C 2: 158,218,746 (GRCm39) probably benign Het
Sorbs2 A G 8: 46,249,389 (GRCm39) Q800R probably benign Het
Srf C A 17: 46,860,912 (GRCm39) G401C probably damaging Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Swap70 C T 7: 109,878,470 (GRCm39) A480V possibly damaging Het
Sycp2 A G 2: 178,023,750 (GRCm39) V422A probably damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tet3 T C 6: 83,381,361 (GRCm39) N269S possibly damaging Het
Thap12 A T 7: 98,366,045 (GRCm39) I738F possibly damaging Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmem229a A T 6: 24,955,010 (GRCm39) F248Y probably damaging Het
Tmprss7 G A 16: 45,504,956 (GRCm39) Q145* probably null Het
Tnc A T 4: 63,911,262 (GRCm39) probably null Het
Tonsl A T 15: 76,508,797 (GRCm39) Y21N probably damaging Het
Tpr A G 1: 150,297,414 (GRCm39) D1009G probably benign Het
Ubr3 T A 2: 69,783,820 (GRCm39) probably null Het
Vcan T C 13: 89,853,653 (GRCm39) N436D possibly damaging Het
Vmn2r104 T A 17: 20,261,031 (GRCm39) Y464F probably damaging Het
Vmn2r44 T A 7: 8,370,981 (GRCm39) R688S probably benign Het
Wdr74 G T 19: 8,715,311 (GRCm39) V157L probably benign Het
Wnt7a T A 6: 91,371,530 (GRCm39) D144V probably benign Het
Zfp106 C T 2: 120,362,162 (GRCm39) A986T possibly damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77,778,749 (GRCm39) splice site probably null
IGL00773:Trpm2 APN 10 77,785,048 (GRCm39) nonsense probably null
IGL00962:Trpm2 APN 10 77,779,750 (GRCm39) splice site probably benign
IGL01093:Trpm2 APN 10 77,768,114 (GRCm39) missense probably benign 0.04
IGL01124:Trpm2 APN 10 77,781,659 (GRCm39) splice site probably benign
IGL01301:Trpm2 APN 10 77,759,818 (GRCm39) missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77,778,830 (GRCm39) nonsense probably null
IGL02175:Trpm2 APN 10 77,773,741 (GRCm39) missense probably benign 0.07
IGL02653:Trpm2 APN 10 77,748,503 (GRCm39) missense probably benign 0.19
IGL02667:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77,754,820 (GRCm39) missense probably benign 0.16
IGL02951:Trpm2 APN 10 77,765,112 (GRCm39) missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77,754,743 (GRCm39) missense probably benign 0.18
IGL03242:Trpm2 APN 10 77,753,568 (GRCm39) missense probably benign
IGL03405:Trpm2 APN 10 77,801,906 (GRCm39) splice site probably benign
Fugit UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
scusate UTSW 10 77,802,828 (GRCm39) nonsense probably null
temporal UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77,759,818 (GRCm39) missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77,779,824 (GRCm39) splice site probably benign
R0332:Trpm2 UTSW 10 77,783,822 (GRCm39) missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77,759,350 (GRCm39) missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77,765,122 (GRCm39) missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77,759,398 (GRCm39) missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77,802,828 (GRCm39) nonsense probably null
R1518:Trpm2 UTSW 10 77,778,839 (GRCm39) missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77,778,833 (GRCm39) missense probably benign 0.14
R1593:Trpm2 UTSW 10 77,778,910 (GRCm39) missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77,771,709 (GRCm39) splice site probably null
R1673:Trpm2 UTSW 10 77,778,778 (GRCm39) missense probably benign
R1912:Trpm2 UTSW 10 77,781,710 (GRCm39) missense probably benign 0.10
R1993:Trpm2 UTSW 10 77,783,823 (GRCm39) missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77,761,600 (GRCm39) missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R2201:Trpm2 UTSW 10 77,756,305 (GRCm39) nonsense probably null
R2217:Trpm2 UTSW 10 77,777,016 (GRCm39) missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77,754,798 (GRCm39) missense probably benign 0.04
R2339:Trpm2 UTSW 10 77,750,640 (GRCm39) splice site probably benign
R2395:Trpm2 UTSW 10 77,783,714 (GRCm39) missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77,766,471 (GRCm39) missense probably benign 0.14
R2405:Trpm2 UTSW 10 77,770,558 (GRCm39) missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77,777,008 (GRCm39) missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3002:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3125:Trpm2 UTSW 10 77,747,208 (GRCm39) missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77,768,136 (GRCm39) missense probably benign 0.03
R3777:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R3778:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R4272:Trpm2 UTSW 10 77,769,476 (GRCm39) missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77,753,559 (GRCm39) missense probably benign 0.44
R4395:Trpm2 UTSW 10 77,765,053 (GRCm39) missense probably benign 0.01
R4423:Trpm2 UTSW 10 77,770,902 (GRCm39) missense probably benign 0.00
R4452:Trpm2 UTSW 10 77,759,427 (GRCm39) missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77,781,750 (GRCm39) missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77,773,972 (GRCm39) missense probably benign 0.05
R4825:Trpm2 UTSW 10 77,777,007 (GRCm39) missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77,768,023 (GRCm39) nonsense probably null
R4943:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77,753,626 (GRCm39) missense probably benign 0.34
R5046:Trpm2 UTSW 10 77,801,852 (GRCm39) missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77,759,355 (GRCm39) missense probably benign 0.06
R5523:Trpm2 UTSW 10 77,771,795 (GRCm39) missense probably benign 0.04
R5562:Trpm2 UTSW 10 77,795,773 (GRCm39) missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77,767,973 (GRCm39) missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77,748,470 (GRCm39) missense probably benign 0.00
R5633:Trpm2 UTSW 10 77,774,187 (GRCm39) missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77,801,814 (GRCm39) missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77,795,734 (GRCm39) missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77,753,547 (GRCm39) missense probably benign 0.00
R6075:Trpm2 UTSW 10 77,770,877 (GRCm39) critical splice donor site probably null
R6092:Trpm2 UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
R6309:Trpm2 UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77,768,061 (GRCm39) missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6579:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6640:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6642:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6798:Trpm2 UTSW 10 77,750,574 (GRCm39) missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77,771,725 (GRCm39) missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7036:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7113:Trpm2 UTSW 10 77,783,765 (GRCm39) missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77,759,848 (GRCm39) missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77,771,710 (GRCm39) critical splice donor site probably null
R7274:Trpm2 UTSW 10 77,759,389 (GRCm39) missense probably benign 0.00
R7379:Trpm2 UTSW 10 77,750,568 (GRCm39) missense probably benign
R7527:Trpm2 UTSW 10 77,801,894 (GRCm39) missense probably benign 0.01
R7571:Trpm2 UTSW 10 77,773,784 (GRCm39) missense probably benign 0.21
R7600:Trpm2 UTSW 10 77,773,885 (GRCm39) missense probably benign 0.02
R7727:Trpm2 UTSW 10 77,761,623 (GRCm39) missense probably benign 0.34
R7771:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R7844:Trpm2 UTSW 10 77,759,340 (GRCm39) missense probably benign 0.00
R8158:Trpm2 UTSW 10 77,783,731 (GRCm39) missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77,771,836 (GRCm39) missense probably benign 0.06
R8275:Trpm2 UTSW 10 77,801,859 (GRCm39) nonsense probably null
R8340:Trpm2 UTSW 10 77,759,458 (GRCm39) nonsense probably null
R8354:Trpm2 UTSW 10 77,769,483 (GRCm39) missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77,747,236 (GRCm39) missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77,746,086 (GRCm39) missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77,768,128 (GRCm39) missense probably benign 0.00
R9144:Trpm2 UTSW 10 77,765,122 (GRCm39) missense probably benign 0.01
R9286:Trpm2 UTSW 10 77,777,014 (GRCm39) missense probably benign 0.06
R9319:Trpm2 UTSW 10 77,785,032 (GRCm39) missense probably damaging 1.00
R9319:Trpm2 UTSW 10 77,778,776 (GRCm39) nonsense probably null
R9381:Trpm2 UTSW 10 77,747,191 (GRCm39) missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77,747,226 (GRCm39) missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77,747,224 (GRCm39) missense probably benign 0.12
R9547:Trpm2 UTSW 10 77,748,467 (GRCm39) missense probably benign 0.33
R9660:Trpm2 UTSW 10 77,766,389 (GRCm39) missense probably benign 0.00
R9663:Trpm2 UTSW 10 77,756,320 (GRCm39) missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77,773,702 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTATAAGTGTTACACTGACTCAAACG -3'
(R):5'- GGGGCCTTGATTCTCTTTGA -3'

Sequencing Primer
(F):5'- GGGATAACAGTCATCTCACGTTGC -3'
(R):5'- CTTTGACCTTCAAGGAGGCAG -3'
Posted On 2014-07-14