Mutagenetix > Incidental Mutation

Incidental Mutation 'R1932:Kansl1'

215493

Institutional Source

Beutler Lab

Gene Symbol

Kansl1

Ensembl Gene

ENSMUSG00000018412

Gene Name

KAT8 regulatory NSL complex subunit 1

Synonyms

1700081L11Rik

MMRRC Submission

039950-MU

Accession Numbers

Genbank: NM_001081045.1; Ensembl: ENSMUST00000018556, ENSMUST00000035872, ENSMUST00000106971, ENSMUST00000106972, ENSMUST00000106974, ENSMUST00000106977, ENSMUST00000134266, ENSMUST00000166536

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1932 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104333229-104468861 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 104335097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 998 (T998A)

Ref Sequence

ENSEMBL: ENSMUSP00000102590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018556] [ENSMUST00000106971] [ENSMUST00000106972] [ENSMUST00000106977] [ENSMUST00000106992]

AlphaFold

Q80TG1

Predicted Effect

probably damaging
Transcript: ENSMUST00000018556
AA Change: T998A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000018556
Gene: ENSMUSG00000018412
AA Change: T998A

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000069188

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106971
AA Change: T1061A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102584
Gene: ENSMUSG00000018412
AA Change: T1061A

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106972
AA Change: T1061A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102585
Gene: ENSMUSG00000018412
AA Change: T1061A

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	822	835	N/A	INTRINSIC
PEHE	879	1029	1.53e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000106977
AA Change: T998A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102590
Gene: ENSMUSG00000018412
AA Change: T998A

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	164	175	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
coiled coil region	283	311	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC
low complexity region	759	772	N/A	INTRINSIC
PEHE	816	966	1.53e-53	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106992

SMART Domains

Protein: ENSMUSP00000102605
Gene: ENSMUSG00000018411

Domain	Start	End	E-Value	Type
low complexity region	69	81	N/A	INTRINSIC
low complexity region	105	154	N/A	INTRINSIC
Pfam:Tubulin-binding	174	205	6.1e-19	PFAM
Pfam:Tubulin-binding	206	236	1.5e-21	PFAM
Pfam:Tubulin-binding	237	267	6.9e-20	PFAM
Pfam:Tubulin-binding	268	299	4.7e-19	PFAM

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that is a subunit of two protein complexes involved with histone acetylation, the MLL1 complex and the NSL1 complex. The corresponding protein in Drosophila interacts with K(lysine) acetyltransferase 8, which is also a subunit of both the MLL1 and NSL1 complexes. [provided by RefSeq, Jun 2012]

Allele List at MGI

All alleles(136) : Gene trapped(136)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	A	9: 44,279,394	Q278H	probably benign	Het
Ace3	T	C	11: 106,004,610		probably null	Het
Aco1	T	C	4: 40,176,499	V221A	probably damaging	Het
Adamts20	T	A	15: 94,404,010	H27L	probably benign	Het
Adamts8	A	G	9: 30,956,512	D544G	probably benign	Het
Angptl4	C	A	17: 33,781,275	E40*	probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atf7ip2	T	A	16: 10,241,703	I369N	possibly damaging	Het
Atp6ap1l	T	A	13: 90,883,687	Y292F	probably damaging	Het
Atp6v1b2	A	T	8: 69,102,807	K217*	probably null	Het
Bid	C	T	6: 120,897,255	A110T	possibly damaging	Het
Blvra	T	A	2: 127,095,148	W174R	probably damaging	Het
Catsperg1	C	T	7: 29,198,143	G239R	probably damaging	Het
Ccdc157	G	T	11: 4,146,549	A400D	probably damaging	Het
Chd2	G	T	7: 73,454,445	P1298T	probably damaging	Het
CK137956	G	A	4: 127,946,858	L352F	possibly damaging	Het
Col22a1	G	A	15: 71,870,140	P503S	unknown	Het
Cox15	C	T	19: 43,746,785	R181H	probably benign	Het
Crem	C	T	18: 3,299,284	G47R	probably benign	Het
Crygs	T	A	16: 22,806,554	T46S	probably benign	Het
Cts8	T	A	13: 61,253,615	H62L	probably damaging	Het
Cyp4a32	T	A	4: 115,611,277	F319I	possibly damaging	Het
Dchs1	T	C	7: 105,765,902	S692G	probably damaging	Het
Ddx23	G	A	15: 98,650,718	R370W	possibly damaging	Het
Defa29	A	T	8: 21,326,849	S43T	probably damaging	Het
Dnajc14	A	G	10: 128,816,792	D573G	probably damaging	Het
Drd5	A	G	5: 38,319,976	Y104C	probably benign	Het
Efcab7	C	T	4: 99,911,018	P102L	probably damaging	Het
Efhc1	A	G	1: 20,967,400	Y267C	probably damaging	Het
Eif2ak4	T	C	2: 118,448,486	Y243H	probably damaging	Het
Gfm2	T	A	13: 97,141,967	I7N	probably damaging	Het
Gmds	A	G	13: 32,127,997	F150L	possibly damaging	Het
Gp2	T	C	7: 119,454,232	T169A	possibly damaging	Het
Grb14	A	G	2: 64,912,802	F508L	probably damaging	Het
Hdac5	T	A	11: 102,195,872		probably benign	Het
Heatr1	T	A	13: 12,435,185	M620K	probably damaging	Het
Herc3	A	G	6: 58,876,793	E608G	probably damaging	Het
Hoxb4	T	C	11: 96,320,041	Y156H	probably damaging	Het
Ifi205	T	A	1: 174,028,414	I17F	possibly damaging	Het
Il2rb	A	T	15: 78,491,777	S25T	possibly damaging	Het
Kcna6	G	T	6: 126,738,488	H479Q	probably benign	Het
Kif2a	T	C	13: 106,978,091	K350R	probably benign	Het
Lct	G	T	1: 128,294,161	A1547E	probably damaging	Het
Lhx9	T	A	1: 138,842,009		probably benign	Het
Lingo1	T	A	9: 56,619,650	I552F	possibly damaging	Het
Lrp4	G	A	2: 91,497,355	W1516*	probably null	Het
Lrp5	C	T	19: 3,610,131	V978I	probably benign	Het
Ltbp1	T	A	17: 75,313,034	D719E	probably benign	Het
Ltbp4	A	G	7: 27,307,766		probably null	Het
Macf1	A	G	4: 123,452,037	I1326T	probably damaging	Het
Manba	T	C	3: 135,544,740	F376S	probably benign	Het
Mink1	T	C	11: 70,608,428		probably null	Het
Nfatc2ip	C	T	7: 126,384,992	V410I	probably damaging	Het
Nlrp1b	A	T	11: 71,182,138	I293N	probably damaging	Het
Olfr432	T	C	1: 174,050,678	Y102H	probably damaging	Het
Otol1	A	C	3: 70,028,104	E476D	probably benign	Het
Pcdhb4	C	T	18: 37,309,541	P635S	probably benign	Het
Pfkfb4	T	A	9: 108,999,169	F91I	probably damaging	Het
Polq	G	A	16: 37,062,304	R1610Q	possibly damaging	Het
Polr3c	A	T	3: 96,719,298	L270H	probably damaging	Het
Ppp1r15b	C	T	1: 133,131,625		probably benign	Het
Prkca	T	G	11: 108,192,149	D90A	probably benign	Het
Sall3	T	C	18: 80,969,753	D1156G	probably benign	Het
Scn7a	A	T	2: 66,676,102	L1481H	probably damaging	Het
Selenon	A	T	4: 134,544,618	I292N	probably damaging	Het
Sema6d	T	A	2: 124,659,886		probably null	Het
Sgpp1	G	T	12: 75,716,179	Y409*	probably null	Het
Sh3pxd2a	A	G	19: 47,267,508	S924P	probably benign	Het
Slc25a13	A	G	6: 6,042,264	V638A	probably benign	Het
Snhg11	T	C	2: 158,376,826		probably benign	Het
Sorbs2	A	G	8: 45,796,352	Q800R	probably benign	Het
Srf	C	A	17: 46,549,986	G401C	probably damaging	Het
Stradb	A	C	1: 58,991,105	N173H	probably benign	Het
Swap70	C	T	7: 110,279,263	A480V	possibly damaging	Het
Sycp2	A	G	2: 178,381,957	V422A	probably damaging	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tet3	T	C	6: 83,404,379	N269S	possibly damaging	Het
Thap12	A	T	7: 98,716,838	I738F	possibly damaging	Het
Tiam2	C	T	17: 3,514,725	R1413C	possibly damaging	Het
Tmem229a	A	T	6: 24,955,011	F248Y	probably damaging	Het
Tmprss7	G	A	16: 45,684,593	Q145*	probably null	Het
Tnc	A	T	4: 63,993,025		probably null	Het
Tonsl	A	T	15: 76,624,597	Y21N	probably damaging	Het
Tpr	A	G	1: 150,421,663	D1009G	probably benign	Het
Trpm2	G	A	10: 77,941,158	A435V	probably damaging	Het
Ubr3	T	A	2: 69,953,476		probably null	Het
Vcan	T	C	13: 89,705,534	N436D	possibly damaging	Het
Vmn2r104	T	A	17: 20,040,769	Y464F	probably damaging	Het
Vmn2r44	T	A	7: 8,367,982	R688S	probably benign	Het
Wdr74	G	T	19: 8,737,947	V157L	probably benign	Het
Wnt7a	T	A	6: 91,394,548	D144V	probably benign	Het
Zfp106	C	T	2: 120,531,681	A986T	possibly damaging	Het

Other mutations in Kansl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00326:Kansl1	APN	11	104424466	missense	probably damaging	0.96
IGL00658:Kansl1	APN	11	104357526	missense	probably benign	0.10
IGL00688:Kansl1	APN	11	104425066	missense	probably damaging	1.00
IGL01121:Kansl1	APN	11	104335596	missense	probably benign	0.01
IGL01624:Kansl1	APN	11	104424552	missense	probably benign	0.13
IGL02187:Kansl1	APN	11	104378831	splice site	probably null
IGL02711:Kansl1	APN	11	104335575	missense	probably damaging	1.00
IGL02965:Kansl1	APN	11	104335165	missense	probably damaging	0.99
kansas	UTSW	11	104424132	missense	possibly damaging	0.94
wichita	UTSW	11	104356767	missense	possibly damaging	0.90
NA:Kansl1	UTSW	11	104342367	missense	probably benign	0.09
R0399:Kansl1	UTSW	11	104424132	missense	possibly damaging	0.94
R0611:Kansl1	UTSW	11	104338186	missense	probably benign	0.31
R0665:Kansl1	UTSW	11	104343538	missense	probably benign
R0667:Kansl1	UTSW	11	104343538	missense	probably benign
R0747:Kansl1	UTSW	11	104342976	missense	probably benign	0.00
R0865:Kansl1	UTSW	11	104424368	missense	probably benign	0.08
R1479:Kansl1	UTSW	11	104342416	missense	probably damaging	1.00
R1679:Kansl1	UTSW	11	104423996	missense	probably damaging	1.00
R1818:Kansl1	UTSW	11	104342457	missense	possibly damaging	0.80
R1922:Kansl1	UTSW	11	104343640	missense	probably damaging	1.00
R2105:Kansl1	UTSW	11	104335559	missense	probably damaging	0.98
R2907:Kansl1	UTSW	11	104424460	missense	possibly damaging	0.82
R3935:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R3936:Kansl1	UTSW	11	104343543	missense	possibly damaging	0.83
R4282:Kansl1	UTSW	11	104378689	missense	probably benign	0.19
R4455:Kansl1	UTSW	11	104424358	missense	possibly damaging	0.47
R4696:Kansl1	UTSW	11	104356767	missense	possibly damaging	0.90
R4846:Kansl1	UTSW	11	104342972	missense	possibly damaging	0.48
R4890:Kansl1	UTSW	11	104343042	missense	probably benign
R4973:Kansl1	UTSW	11	104424321	missense	probably damaging	1.00
R4975:Kansl1	UTSW	11	104335564	missense	probably damaging	1.00
R5085:Kansl1	UTSW	11	104424342	missense	probably damaging	1.00
R5227:Kansl1	UTSW	11	104356814	missense	probably benign	0.19
R5310:Kansl1	UTSW	11	104424858	missense	possibly damaging	0.95
R5652:Kansl1	UTSW	11	104338166	missense	probably damaging	1.00
R5677:Kansl1	UTSW	11	104335148	missense	probably benign	0.00
R5980:Kansl1	UTSW	11	104343637	missense	possibly damaging	0.96
R6013:Kansl1	UTSW	11	104350639	missense	probably benign	0.00
R6253:Kansl1	UTSW	11	104357526	missense	probably benign	0.10
R7751:Kansl1	UTSW	11	104424064	missense	probably benign	0.30
R7880:Kansl1	UTSW	11	104424153	missense	probably damaging	1.00
R7888:Kansl1	UTSW	11	104342422	missense	probably benign	0.00
R7935:Kansl1	UTSW	11	104424286	missense	probably damaging	0.99
R8251:Kansl1	UTSW	11	104424360	missense	probably benign
R9033:Kansl1	UTSW	11	104357530	missense	probably benign	0.00
R9192:Kansl1	UTSW	11	104336316	missense	probably damaging	1.00
R9494:Kansl1	UTSW	11	104356740	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTGCTCAGGTGTGACATG -3'
(R):5'- TCCCCAAGTTTGAGGTCAGG -3'

Sequencing Primer
(F):5'- TGCTCAGGTGTGACATGAAAAC -3'
(R):5'- GGCCTTGGCTCTGGAAACTG -3'

Posted On

2014-07-14