Incidental Mutation 'R1932:Vcan'
ID215500
Institutional Source Beutler Lab
Gene Symbol Vcan
Ensembl Gene ENSMUSG00000021614
Gene Nameversican
SynonymsPG-M, hdf, DPEAAE, heart defect, Cspg2, 5430420N07Rik
MMRRC Submission 039950-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1932 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location89655312-89742509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89705534 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 436 (N436D)
Ref Sequence ENSEMBL: ENSMUSP00000105173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109543] [ENSMUST00000109544] [ENSMUST00000109546] [ENSMUST00000159910]
Predicted Effect probably benign
Transcript: ENSMUST00000109543
SMART Domains Protein: ENSMUSP00000105170
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
EGF 351 384 2.72e-7 SMART
EGF_CA 386 422 1.16e-10 SMART
CLECT 428 549 3.08e-34 SMART
CCP 555 611 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109544
AA Change: N436D

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105171
Gene: ENSMUSG00000021614
AA Change: N436D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
EGF 1311 1344 2.72e-7 SMART
EGF_CA 1346 1382 1.16e-10 SMART
CLECT 1388 1509 3.08e-34 SMART
CCP 1515 1571 1.04e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109546
AA Change: N436D

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105173
Gene: ENSMUSG00000021614
AA Change: N436D

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 728 743 N/A INTRINSIC
low complexity region 1205 1219 N/A INTRINSIC
low complexity region 1322 1333 N/A INTRINSIC
low complexity region 1546 1569 N/A INTRINSIC
low complexity region 1837 1852 N/A INTRINSIC
low complexity region 2013 2026 N/A INTRINSIC
low complexity region 2354 2367 N/A INTRINSIC
low complexity region 2468 2482 N/A INTRINSIC
low complexity region 2719 2728 N/A INTRINSIC
EGF 3050 3083 2.72e-7 SMART
EGF_CA 3085 3121 1.16e-10 SMART
CLECT 3127 3248 3.08e-34 SMART
CCP 3254 3310 1.04e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159910
SMART Domains Protein: ENSMUSP00000125446
Gene: ENSMUSG00000021614

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 29 148 1.4e-7 SMART
LINK 148 245 1.4e-53 SMART
LINK 249 347 8.8e-60 SMART
low complexity region 362 373 N/A INTRINSIC
low complexity region 586 609 N/A INTRINSIC
low complexity region 877 892 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
low complexity region 1394 1407 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
low complexity region 1759 1768 N/A INTRINSIC
EGF 2090 2123 2.72e-7 SMART
EGF_CA 2125 2161 1.16e-10 SMART
CLECT 2167 2288 3.08e-34 SMART
CCP 2294 2350 1.04e-8 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the aggrecan/versican proteoglycan family. The protein encoded is a large chondroitin sulfate proteoglycan and is a major component of the extracellular matrix. This protein is involved in cell adhesion, proliferation, proliferation, migration and angiogenesis and plays a central role in tissue morphogenesis and maintenance. Mutations in this gene are the cause of Wagner syndrome type 1. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for an insertional mutation exhibit anterior-posterior segmental defects of the heart, lack endocardial cushions of the conus and atrioventricular region, and die and around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,279,394 Q278H probably benign Het
Ace3 T C 11: 106,004,610 probably null Het
Aco1 T C 4: 40,176,499 V221A probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamts8 A G 9: 30,956,512 D544G probably benign Het
Angptl4 C A 17: 33,781,275 E40* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip2 T A 16: 10,241,703 I369N possibly damaging Het
Atp6ap1l T A 13: 90,883,687 Y292F probably damaging Het
Atp6v1b2 A T 8: 69,102,807 K217* probably null Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Blvra T A 2: 127,095,148 W174R probably damaging Het
Catsperg1 C T 7: 29,198,143 G239R probably damaging Het
Ccdc157 G T 11: 4,146,549 A400D probably damaging Het
Chd2 G T 7: 73,454,445 P1298T probably damaging Het
CK137956 G A 4: 127,946,858 L352F possibly damaging Het
Col22a1 G A 15: 71,870,140 P503S unknown Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Crem C T 18: 3,299,284 G47R probably benign Het
Crygs T A 16: 22,806,554 T46S probably benign Het
Cts8 T A 13: 61,253,615 H62L probably damaging Het
Cyp4a32 T A 4: 115,611,277 F319I possibly damaging Het
Dchs1 T C 7: 105,765,902 S692G probably damaging Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Defa29 A T 8: 21,326,849 S43T probably damaging Het
Dnajc14 A G 10: 128,816,792 D573G probably damaging Het
Drd5 A G 5: 38,319,976 Y104C probably benign Het
Efcab7 C T 4: 99,911,018 P102L probably damaging Het
Efhc1 A G 1: 20,967,400 Y267C probably damaging Het
Eif2ak4 T C 2: 118,448,486 Y243H probably damaging Het
Gfm2 T A 13: 97,141,967 I7N probably damaging Het
Gmds A G 13: 32,127,997 F150L possibly damaging Het
Gp2 T C 7: 119,454,232 T169A possibly damaging Het
Grb14 A G 2: 64,912,802 F508L probably damaging Het
Hdac5 T A 11: 102,195,872 probably benign Het
Heatr1 T A 13: 12,435,185 M620K probably damaging Het
Herc3 A G 6: 58,876,793 E608G probably damaging Het
Hoxb4 T C 11: 96,320,041 Y156H probably damaging Het
Ifi205 T A 1: 174,028,414 I17F possibly damaging Het
Il2rb A T 15: 78,491,777 S25T possibly damaging Het
Kansl1 T C 11: 104,335,097 T998A probably damaging Het
Kcna6 G T 6: 126,738,488 H479Q probably benign Het
Kif2a T C 13: 106,978,091 K350R probably benign Het
Lct G T 1: 128,294,161 A1547E probably damaging Het
Lhx9 T A 1: 138,842,009 probably benign Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Lrp4 G A 2: 91,497,355 W1516* probably null Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Ltbp1 T A 17: 75,313,034 D719E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Macf1 A G 4: 123,452,037 I1326T probably damaging Het
Manba T C 3: 135,544,740 F376S probably benign Het
Mink1 T C 11: 70,608,428 probably null Het
Nfatc2ip C T 7: 126,384,992 V410I probably damaging Het
Nlrp1b A T 11: 71,182,138 I293N probably damaging Het
Olfr432 T C 1: 174,050,678 Y102H probably damaging Het
Otol1 A C 3: 70,028,104 E476D probably benign Het
Pcdhb4 C T 18: 37,309,541 P635S probably benign Het
Pfkfb4 T A 9: 108,999,169 F91I probably damaging Het
Polq G A 16: 37,062,304 R1610Q possibly damaging Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Ppp1r15b C T 1: 133,131,625 probably benign Het
Prkca T G 11: 108,192,149 D90A probably benign Het
Sall3 T C 18: 80,969,753 D1156G probably benign Het
Scn7a A T 2: 66,676,102 L1481H probably damaging Het
Selenon A T 4: 134,544,618 I292N probably damaging Het
Sema6d T A 2: 124,659,886 probably null Het
Sgpp1 G T 12: 75,716,179 Y409* probably null Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc25a13 A G 6: 6,042,264 V638A probably benign Het
Snhg11 T C 2: 158,376,826 probably benign Het
Sorbs2 A G 8: 45,796,352 Q800R probably benign Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Swap70 C T 7: 110,279,263 A480V possibly damaging Het
Sycp2 A G 2: 178,381,957 V422A probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet3 T C 6: 83,404,379 N269S possibly damaging Het
Thap12 A T 7: 98,716,838 I738F possibly damaging Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmem229a A T 6: 24,955,011 F248Y probably damaging Het
Tmprss7 G A 16: 45,684,593 Q145* probably null Het
Tnc A T 4: 63,993,025 probably null Het
Tonsl A T 15: 76,624,597 Y21N probably damaging Het
Tpr A G 1: 150,421,663 D1009G probably benign Het
Trpm2 G A 10: 77,941,158 A435V probably damaging Het
Ubr3 T A 2: 69,953,476 probably null Het
Vmn2r104 T A 17: 20,040,769 Y464F probably damaging Het
Vmn2r44 T A 7: 8,367,982 R688S probably benign Het
Wdr74 G T 19: 8,737,947 V157L probably benign Het
Wnt7a T A 6: 91,394,548 D144V probably benign Het
Zfp106 C T 2: 120,531,681 A986T possibly damaging Het
Other mutations in Vcan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Vcan APN 13 89704702 missense probably damaging 1.00
IGL00502:Vcan APN 13 89692319 missense probably benign
IGL00504:Vcan APN 13 89691275 missense possibly damaging 0.70
IGL00566:Vcan APN 13 89688979 missense probably benign 0.01
IGL00701:Vcan APN 13 89703726 missense probably benign
IGL00743:Vcan APN 13 89725306 missense probably damaging 0.98
IGL00962:Vcan APN 13 89662052 missense probably damaging 1.00
IGL01085:Vcan APN 13 89679958 missense probably damaging 1.00
IGL01317:Vcan APN 13 89691668 missense probably benign 0.00
IGL01349:Vcan APN 13 89703943 missense probably damaging 0.98
IGL01391:Vcan APN 13 89704169 missense probably benign 0.19
IGL01644:Vcan APN 13 89688675 missense probably benign 0.13
IGL01657:Vcan APN 13 89690586 missense probably damaging 1.00
IGL01707:Vcan APN 13 89689745 missense probably damaging 1.00
IGL01764:Vcan APN 13 89725388 missense probably damaging 1.00
IGL01920:Vcan APN 13 89689205 missense probably benign 0.04
IGL01989:Vcan APN 13 89689359 missense possibly damaging 0.86
IGL01999:Vcan APN 13 89684438 missense probably damaging 1.00
IGL02083:Vcan APN 13 89725565 missense probably damaging 1.00
IGL02160:Vcan APN 13 89684493 missense probably damaging 1.00
IGL02217:Vcan APN 13 89703077 missense probably damaging 1.00
IGL02522:Vcan APN 13 89704849 missense probably benign 0.00
IGL02527:Vcan APN 13 89690657 missense possibly damaging 0.95
IGL02926:Vcan APN 13 89688623 missense probably damaging 0.98
IGL03061:Vcan APN 13 89703275 missense probably benign 0.25
IGL03331:Vcan APN 13 89661932 missense probably damaging 1.00
IGL03352:Vcan APN 13 89705006 missense probably benign 0.00
R0041:Vcan UTSW 13 89661985 missense probably damaging 1.00
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0102:Vcan UTSW 13 89703668 missense probably benign 0.01
R0109:Vcan UTSW 13 89678073 critical splice donor site probably null
R0139:Vcan UTSW 13 89691261 missense probably damaging 1.00
R0295:Vcan UTSW 13 89712191 missense probably benign 0.06
R0375:Vcan UTSW 13 89691275 missense probably damaging 0.99
R0379:Vcan UTSW 13 89703546 missense probably damaging 0.99
R0457:Vcan UTSW 13 89703199 missense possibly damaging 0.78
R0482:Vcan UTSW 13 89678145 missense probably damaging 1.00
R0485:Vcan UTSW 13 89704660 missense possibly damaging 0.92
R0532:Vcan UTSW 13 89703772 missense probably damaging 0.99
R0561:Vcan UTSW 13 89712253 missense probably damaging 1.00
R0561:Vcan UTSW 13 89731464 missense possibly damaging 0.86
R0636:Vcan UTSW 13 89704706 missense probably damaging 0.99
R0636:Vcan UTSW 13 89712267 missense probably damaging 1.00
R0680:Vcan UTSW 13 89679822 missense probably damaging 1.00
R0849:Vcan UTSW 13 89704953 missense possibly damaging 0.75
R1006:Vcan UTSW 13 89685077 critical splice donor site probably null
R1104:Vcan UTSW 13 89692410 missense probably damaging 1.00
R1118:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1137:Vcan UTSW 13 89704303 missense probably damaging 1.00
R1199:Vcan UTSW 13 89679794 splice site probably null
R1219:Vcan UTSW 13 89679904 missense probably damaging 1.00
R1296:Vcan UTSW 13 89657556 missense probably damaging 1.00
R1332:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1336:Vcan UTSW 13 89693055 missense probably damaging 1.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1403:Vcan UTSW 13 89688484 missense probably benign 0.00
R1546:Vcan UTSW 13 89692956 missense probably damaging 0.99
R1604:Vcan UTSW 13 89689661 missense probably benign 0.42
R1616:Vcan UTSW 13 89705663 missense probably damaging 1.00
R1636:Vcan UTSW 13 89703667 missense possibly damaging 0.90
R1654:Vcan UTSW 13 89661946 missense probably damaging 1.00
R1680:Vcan UTSW 13 89703547 missense probably benign 0.19
R1694:Vcan UTSW 13 89688483 missense probably damaging 0.98
R1712:Vcan UTSW 13 89721775 missense probably damaging 1.00
R1754:Vcan UTSW 13 89704735 missense probably benign 0.01
R1756:Vcan UTSW 13 89691681 missense probably benign 0.05
R1824:Vcan UTSW 13 89705212 missense possibly damaging 0.75
R1852:Vcan UTSW 13 89705392 missense probably damaging 0.99
R1868:Vcan UTSW 13 89690871 missense probably benign 0.12
R1920:Vcan UTSW 13 89693015 missense probably damaging 1.00
R1934:Vcan UTSW 13 89702926 missense probably damaging 1.00
R1942:Vcan UTSW 13 89703424 missense probably benign 0.01
R1964:Vcan UTSW 13 89692742 missense probably benign 0.02
R1970:Vcan UTSW 13 89689038 missense probably damaging 1.00
R2045:Vcan UTSW 13 89690985 missense probably benign 0.00
R2110:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2111:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2112:Vcan UTSW 13 89693303 missense probably damaging 1.00
R2136:Vcan UTSW 13 89689737 missense probably damaging 1.00
R2158:Vcan UTSW 13 89703529 missense possibly damaging 0.68
R2376:Vcan UTSW 13 89703410 missense possibly damaging 0.80
R2385:Vcan UTSW 13 89689449 missense probably damaging 1.00
R2443:Vcan UTSW 13 89704675 missense probably damaging 1.00
R2876:Vcan UTSW 13 89704237 missense probably damaging 1.00
R3607:Vcan UTSW 13 89703301 missense probably damaging 0.98
R4042:Vcan UTSW 13 89692543 missense probably benign 0.35
R4043:Vcan UTSW 13 89692543 missense probably benign 0.35
R4044:Vcan UTSW 13 89692543 missense probably benign 0.35
R4065:Vcan UTSW 13 89679887 missense probably damaging 1.00
R4161:Vcan UTSW 13 89685158 missense probably damaging 1.00
R4178:Vcan UTSW 13 89725547 missense probably damaging 1.00
R4290:Vcan UTSW 13 89725486 missense probably damaging 1.00
R4530:Vcan UTSW 13 89704028 missense probably damaging 0.97
R4666:Vcan UTSW 13 89679934 missense probably damaging 1.00
R4785:Vcan UTSW 13 89705789 missense probably damaging 1.00
R4870:Vcan UTSW 13 89704739 missense probably benign 0.01
R4973:Vcan UTSW 13 89688842 missense probably benign 0.30
R5037:Vcan UTSW 13 89703977 missense probably damaging 1.00
R5104:Vcan UTSW 13 89657472 intron probably benign
R5124:Vcan UTSW 13 89725517 missense probably damaging 1.00
R5129:Vcan UTSW 13 89690240 missense probably damaging 1.00
R5198:Vcan UTSW 13 89690872 missense probably damaging 1.00
R5240:Vcan UTSW 13 89692532 missense probably benign 0.08
R5254:Vcan UTSW 13 89691600 missense probably damaging 0.99
R5280:Vcan UTSW 13 89690286 missense probably benign 0.00
R5522:Vcan UTSW 13 89691810 missense possibly damaging 0.62
R5557:Vcan UTSW 13 89703112 missense possibly damaging 0.77
R5568:Vcan UTSW 13 89688671 missense probably damaging 1.00
R5578:Vcan UTSW 13 89691503 missense probably benign 0.01
R5627:Vcan UTSW 13 89691135 frame shift probably null
R5687:Vcan UTSW 13 89678134 missense probably damaging 1.00
R5752:Vcan UTSW 13 89679950 missense probably damaging 1.00
R5879:Vcan UTSW 13 89703952 missense probably damaging 0.99
R5941:Vcan UTSW 13 89692691 missense probably damaging 0.98
R6113:Vcan UTSW 13 89657536 nonsense probably null
R6135:Vcan UTSW 13 89689926 missense probably benign 0.36
R6252:Vcan UTSW 13 89691220 nonsense probably null
R6280:Vcan UTSW 13 89725373 missense probably damaging 1.00
R6317:Vcan UTSW 13 89691597 missense probably benign 0.22
R6327:Vcan UTSW 13 89704832 missense probably damaging 0.99
R6460:Vcan UTSW 13 89690687 missense possibly damaging 0.61
R6669:Vcan UTSW 13 89704731 missense probably benign 0.21
R6744:Vcan UTSW 13 89705182 missense probably damaging 1.00
R6819:Vcan UTSW 13 89705125 missense probably benign 0.00
R6880:Vcan UTSW 13 89712381 missense probably damaging 1.00
R6956:Vcan UTSW 13 89689431 missense probably damaging 0.99
R6971:Vcan UTSW 13 89678133 missense probably damaging 1.00
R6985:Vcan UTSW 13 89679956 missense probably damaging 1.00
R6994:Vcan UTSW 13 89693407 missense possibly damaging 0.94
R6997:Vcan UTSW 13 89690618 missense probably damaging 0.98
R7029:Vcan UTSW 13 89690241 missense probably damaging 1.00
R7066:Vcan UTSW 13 89705686 missense probably damaging 1.00
R7156:Vcan UTSW 13 89689110 missense possibly damaging 0.95
R7171:Vcan UTSW 13 89725591 missense probably damaging 1.00
R7176:Vcan UTSW 13 89688936 missense probably benign 0.01
R7229:Vcan UTSW 13 89705270 missense possibly damaging 0.87
R7250:Vcan UTSW 13 89721686 missense probably damaging 1.00
R7250:Vcan UTSW 13 89731457 critical splice donor site probably null
R7262:Vcan UTSW 13 89705161 missense possibly damaging 0.62
R7289:Vcan UTSW 13 89692733 nonsense probably null
R7299:Vcan UTSW 13 89705266 missense probably benign
R7301:Vcan UTSW 13 89705266 missense probably benign
R7425:Vcan UTSW 13 89689832 missense probably damaging 0.99
R7514:Vcan UTSW 13 89704118 missense probably damaging 0.97
R7579:Vcan UTSW 13 89692458 missense probably damaging 1.00
R7618:Vcan UTSW 13 89692223 missense probably damaging 0.99
R7655:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7656:Vcan UTSW 13 89685114 missense probably damaging 1.00
R7676:Vcan UTSW 13 89691789 missense probably damaging 1.00
R7719:Vcan UTSW 13 89704619 missense probably damaging 0.98
R7753:Vcan UTSW 13 89689323 missense probably damaging 1.00
R7762:Vcan UTSW 13 89692937 missense probably damaging 1.00
R7778:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7824:Vcan UTSW 13 89688654 missense probably damaging 1.00
R7995:Vcan UTSW 13 89691858 missense probably benign
R7998:Vcan UTSW 13 89704327 missense probably damaging 1.00
R8033:Vcan UTSW 13 89704360 missense probably benign 0.04
R8061:Vcan UTSW 13 89657290 missense probably benign 0.45
R8103:Vcan UTSW 13 89657658 missense probably damaging 1.00
R8103:Vcan UTSW 13 89703320 nonsense probably null
R8124:Vcan UTSW 13 89704254 missense possibly damaging 0.93
R8162:Vcan UTSW 13 89704987 nonsense probably null
R8166:Vcan UTSW 13 89692736 missense probably benign 0.02
R8274:Vcan UTSW 13 89704970 missense probably benign 0.02
R8284:Vcan UTSW 13 89704335 missense possibly damaging 0.68
R8417:Vcan UTSW 13 89688743 missense probably benign 0.19
X0058:Vcan UTSW 13 89692493 missense probably benign 0.21
X0065:Vcan UTSW 13 89705749 missense probably damaging 0.96
Z1176:Vcan UTSW 13 89692571 missense probably benign 0.10
Z1177:Vcan UTSW 13 89703524 missense probably benign 0.00
Z1177:Vcan UTSW 13 89703788 nonsense probably null
Z1177:Vcan UTSW 13 89704073 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGGGTCACTTCTGTGG -3'
(R):5'- CTGACAGAGCTACACCAGTC -3'

Sequencing Primer
(F):5'- GATGTTACTAAGGGGCCCACTTC -3'
(R):5'- GAGCTACACCAGTCATTCCATTAG -3'
Posted On2014-07-14