Mutagenetix > Incidental Mutation

Incidental Mutation 'R1932:Col22a1'

215504

Institutional Source

Beutler Lab

Gene Symbol

Col22a1

Ensembl Gene

ENSMUSG00000079022

Gene Name

collagen, type XXII, alpha 1

Synonyms

C80743, 2310067L16Rik

MMRRC Submission

039950-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1932 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71795795-72034227 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 71870140 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 503 (P503S)

Ref Sequence

ENSEMBL: ENSMUSP00000155641 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000159993] [ENSMUST00000160513] [ENSMUST00000229585]

AlphaFold

E9Q7P1

Predicted Effect

unknown
Transcript: ENSMUST00000159993
AA Change: P1058S

SMART Domains

Protein: ENSMUSP00000125069
Gene: ENSMUSG00000079022
AA Change: P1058S

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
VWA	45	227	1.35e-51	SMART
TSPN	248	436	1.26e-33	SMART
low complexity region	454	470	N/A	INTRINSIC
internal_repeat_3	494	555	1.96e-13	PROSPERO
internal_repeat_1	496	643	1.49e-19	PROSPERO
low complexity region	644	657	N/A	INTRINSIC
low complexity region	673	707	N/A	INTRINSIC
Pfam:Collagen	751	823	1.5e-9	PFAM
Pfam:Collagen	810	863	2.3e-10	PFAM
Pfam:Collagen	869	931	4.8e-11	PFAM
Pfam:Collagen	926	990	1.1e-10	PFAM
Pfam:Collagen	1031	1087	1.7e-10	PFAM
Pfam:Collagen	1104	1162	1.8e-11	PFAM
low complexity region	1173	1227	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
internal_repeat_2	1257	1348	3.25e-18	PROSPERO
internal_repeat_4	1268	1347	9.67e-7	PROSPERO
Pfam:Collagen	1389	1448	4e-10	PFAM
Pfam:Collagen	1481	1540	2.6e-9	PFAM
low complexity region	1546	1558	N/A	INTRINSIC
low complexity region	1580	1590	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000160513
AA Change: P169S

SMART Domains

Protein: ENSMUSP00000124270
Gene: ENSMUSG00000079022
AA Change: P169S

Domain	Start	End	E-Value	Type
Pfam:Collagen	1	60	5.7e-13	PFAM
Pfam:Collagen	43	102	1.3e-12	PFAM
Pfam:Collagen	100	143	2.2e-8	PFAM
Pfam:Collagen	142	194	1.9e-11	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000229585
AA Change: P503S

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL22A1, a member of the FACIT (fibrillar-associated collagens with interrupted triple helices) subgroup of the collagen protein family, specifically localizes to tissue junctions (Koch et al., 2004 [PubMed 15016833]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg4	T	A	9: 44,279,394	Q278H	probably benign	Het
Ace3	T	C	11: 106,004,610		probably null	Het
Aco1	T	C	4: 40,176,499	V221A	probably damaging	Het
Adamts20	T	A	15: 94,404,010	H27L	probably benign	Het
Adamts8	A	G	9: 30,956,512	D544G	probably benign	Het
Angptl4	C	A	17: 33,781,275	E40*	probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atf7ip2	T	A	16: 10,241,703	I369N	possibly damaging	Het
Atp6ap1l	T	A	13: 90,883,687	Y292F	probably damaging	Het
Atp6v1b2	A	T	8: 69,102,807	K217*	probably null	Het
Bid	C	T	6: 120,897,255	A110T	possibly damaging	Het
Blvra	T	A	2: 127,095,148	W174R	probably damaging	Het
Catsperg1	C	T	7: 29,198,143	G239R	probably damaging	Het
Ccdc157	G	T	11: 4,146,549	A400D	probably damaging	Het
Chd2	G	T	7: 73,454,445	P1298T	probably damaging	Het
CK137956	G	A	4: 127,946,858	L352F	possibly damaging	Het
Cox15	C	T	19: 43,746,785	R181H	probably benign	Het
Crem	C	T	18: 3,299,284	G47R	probably benign	Het
Crygs	T	A	16: 22,806,554	T46S	probably benign	Het
Cts8	T	A	13: 61,253,615	H62L	probably damaging	Het
Cyp4a32	T	A	4: 115,611,277	F319I	possibly damaging	Het
Dchs1	T	C	7: 105,765,902	S692G	probably damaging	Het
Ddx23	G	A	15: 98,650,718	R370W	possibly damaging	Het
Defa29	A	T	8: 21,326,849	S43T	probably damaging	Het
Dnajc14	A	G	10: 128,816,792	D573G	probably damaging	Het
Drd5	A	G	5: 38,319,976	Y104C	probably benign	Het
Efcab7	C	T	4: 99,911,018	P102L	probably damaging	Het
Efhc1	A	G	1: 20,967,400	Y267C	probably damaging	Het
Eif2ak4	T	C	2: 118,448,486	Y243H	probably damaging	Het
Gfm2	T	A	13: 97,141,967	I7N	probably damaging	Het
Gmds	A	G	13: 32,127,997	F150L	possibly damaging	Het
Gp2	T	C	7: 119,454,232	T169A	possibly damaging	Het
Grb14	A	G	2: 64,912,802	F508L	probably damaging	Het
Hdac5	T	A	11: 102,195,872		probably benign	Het
Heatr1	T	A	13: 12,435,185	M620K	probably damaging	Het
Herc3	A	G	6: 58,876,793	E608G	probably damaging	Het
Hoxb4	T	C	11: 96,320,041	Y156H	probably damaging	Het
Ifi205	T	A	1: 174,028,414	I17F	possibly damaging	Het
Il2rb	A	T	15: 78,491,777	S25T	possibly damaging	Het
Kansl1	T	C	11: 104,335,097	T998A	probably damaging	Het
Kcna6	G	T	6: 126,738,488	H479Q	probably benign	Het
Kif2a	T	C	13: 106,978,091	K350R	probably benign	Het
Lct	G	T	1: 128,294,161	A1547E	probably damaging	Het
Lhx9	T	A	1: 138,842,009		probably benign	Het
Lingo1	T	A	9: 56,619,650	I552F	possibly damaging	Het
Lrp4	G	A	2: 91,497,355	W1516*	probably null	Het
Lrp5	C	T	19: 3,610,131	V978I	probably benign	Het
Ltbp1	T	A	17: 75,313,034	D719E	probably benign	Het
Ltbp4	A	G	7: 27,307,766		probably null	Het
Macf1	A	G	4: 123,452,037	I1326T	probably damaging	Het
Manba	T	C	3: 135,544,740	F376S	probably benign	Het
Mink1	T	C	11: 70,608,428		probably null	Het
Nfatc2ip	C	T	7: 126,384,992	V410I	probably damaging	Het
Nlrp1b	A	T	11: 71,182,138	I293N	probably damaging	Het
Olfr432	T	C	1: 174,050,678	Y102H	probably damaging	Het
Otol1	A	C	3: 70,028,104	E476D	probably benign	Het
Pcdhb4	C	T	18: 37,309,541	P635S	probably benign	Het
Pfkfb4	T	A	9: 108,999,169	F91I	probably damaging	Het
Polq	G	A	16: 37,062,304	R1610Q	possibly damaging	Het
Polr3c	A	T	3: 96,719,298	L270H	probably damaging	Het
Ppp1r15b	C	T	1: 133,131,625		probably benign	Het
Prkca	T	G	11: 108,192,149	D90A	probably benign	Het
Sall3	T	C	18: 80,969,753	D1156G	probably benign	Het
Scn7a	A	T	2: 66,676,102	L1481H	probably damaging	Het
Selenon	A	T	4: 134,544,618	I292N	probably damaging	Het
Sema6d	T	A	2: 124,659,886		probably null	Het
Sgpp1	G	T	12: 75,716,179	Y409*	probably null	Het
Sh3pxd2a	A	G	19: 47,267,508	S924P	probably benign	Het
Slc25a13	A	G	6: 6,042,264	V638A	probably benign	Het
Snhg11	T	C	2: 158,376,826		probably benign	Het
Sorbs2	A	G	8: 45,796,352	Q800R	probably benign	Het
Srf	C	A	17: 46,549,986	G401C	probably damaging	Het
Stradb	A	C	1: 58,991,105	N173H	probably benign	Het
Swap70	C	T	7: 110,279,263	A480V	possibly damaging	Het
Sycp2	A	G	2: 178,381,957	V422A	probably damaging	Het
Taf4	G	A	2: 179,932,029	T682M	probably damaging	Het
Tet3	T	C	6: 83,404,379	N269S	possibly damaging	Het
Thap12	A	T	7: 98,716,838	I738F	possibly damaging	Het
Tiam2	C	T	17: 3,514,725	R1413C	possibly damaging	Het
Tmem229a	A	T	6: 24,955,011	F248Y	probably damaging	Het
Tmprss7	G	A	16: 45,684,593	Q145*	probably null	Het
Tnc	A	T	4: 63,993,025		probably null	Het
Tonsl	A	T	15: 76,624,597	Y21N	probably damaging	Het
Tpr	A	G	1: 150,421,663	D1009G	probably benign	Het
Trpm2	G	A	10: 77,941,158	A435V	probably damaging	Het
Ubr3	T	A	2: 69,953,476		probably null	Het
Vcan	T	C	13: 89,705,534	N436D	possibly damaging	Het
Vmn2r104	T	A	17: 20,040,769	Y464F	probably damaging	Het
Vmn2r44	T	A	7: 8,367,982	R688S	probably benign	Het
Wdr74	G	T	19: 8,737,947	V157L	probably benign	Het
Wnt7a	T	A	6: 91,394,548	D144V	probably benign	Het
Zfp106	C	T	2: 120,531,681	A986T	possibly damaging	Het

Other mutations in Col22a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Col22a1	APN	15	71860958	critical splice donor site	probably null
IGL00434:Col22a1	APN	15	72006675	missense	possibly damaging	0.71
IGL00721:Col22a1	APN	15	71846177	missense	unknown
IGL00902:Col22a1	APN	15	71964659	missense	probably damaging	1.00
IGL01311:Col22a1	APN	15	71973637	splice site	probably benign
IGL01329:Col22a1	APN	15	71907040	missense	probably benign	0.02
IGL01527:Col22a1	APN	15	71907031	missense	probably damaging	0.98
IGL01870:Col22a1	APN	15	71952528	missense	probably benign	0.07
IGL02002:Col22a1	APN	15	71811097	splice site	probably benign
IGL02248:Col22a1	APN	15	71799448	missense	unknown
IGL02322:Col22a1	APN	15	71822653	missense	unknown
IGL02472:Col22a1	APN	15	71827753	splice site	probably benign
IGL02685:Col22a1	APN	15	71801915	missense	unknown
IGL02888:Col22a1	APN	15	71846219	missense	unknown
IGL02971:Col22a1	APN	15	72006738	missense	probably damaging	1.00
IGL03175:Col22a1	APN	15	71969103	missense	possibly damaging	0.81
IGL03240:Col22a1	APN	15	71807928	missense	unknown
R0083:Col22a1	UTSW	15	71890497	missense	possibly damaging	0.70
R0383:Col22a1	UTSW	15	71869004	missense	unknown
R0449:Col22a1	UTSW	15	71962671	critical splice donor site	probably null
R0508:Col22a1	UTSW	15	71933413	missense	unknown
R0944:Col22a1	UTSW	15	71881662	missense	probably benign	0.03
R1289:Col22a1	UTSW	15	71837377	missense	unknown
R1436:Col22a1	UTSW	15	71922957	splice site	probably benign
R1439:Col22a1	UTSW	15	71952377	splice site	probably benign
R1460:Col22a1	UTSW	15	71821931	missense	unknown
R1680:Col22a1	UTSW	15	71799361	missense	unknown
R1715:Col22a1	UTSW	15	72006981	missense	possibly damaging	0.79
R1742:Col22a1	UTSW	15	71801913	missense	unknown
R1745:Col22a1	UTSW	15	72006787	missense	probably damaging	1.00
R1763:Col22a1	UTSW	15	72007176	missense	probably damaging	0.96
R2125:Col22a1	UTSW	15	71848577	missense	unknown
R2126:Col22a1	UTSW	15	71857253	nonsense	probably null
R2137:Col22a1	UTSW	15	72006948	missense	possibly damaging	0.46
R2860:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2861:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R2862:Col22a1	UTSW	15	71815943	critical splice donor site	probably null
R3704:Col22a1	UTSW	15	71970307	missense	probably damaging	1.00
R3778:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R3940:Col22a1	UTSW	15	71981933	nonsense	probably null
R3950:Col22a1	UTSW	15	71977358	missense	possibly damaging	0.90
R4240:Col22a1	UTSW	15	72007131	missense	probably damaging	1.00
R4531:Col22a1	UTSW	15	72007149	missense	probably damaging	1.00
R4597:Col22a1	UTSW	15	71964662	missense	possibly damaging	0.83
R4604:Col22a1	UTSW	15	71952339	missense	probably benign	0.36
R4654:Col22a1	UTSW	15	71973695	missense	possibly damaging	0.95
R4782:Col22a1	UTSW	15	71801925	missense	unknown
R4847:Col22a1	UTSW	15	71799499	missense	unknown
R4980:Col22a1	UTSW	15	71801943	missense	unknown
R4981:Col22a1	UTSW	15	71861066	missense	unknown
R4996:Col22a1	UTSW	15	72007161	missense	probably damaging	0.99
R5007:Col22a1	UTSW	15	71944422	missense	probably damaging	1.00
R5135:Col22a1	UTSW	15	71799337	missense	unknown
R5197:Col22a1	UTSW	15	72009406	missense	probably damaging	0.96
R5292:Col22a1	UTSW	15	71970336	missense	probably damaging	1.00
R5449:Col22a1	UTSW	15	71821949	missense	unknown
R5480:Col22a1	UTSW	15	71964611	missense	probably damaging	0.98
R5627:Col22a1	UTSW	15	71981918	missense	probably damaging	0.98
R5828:Col22a1	UTSW	15	72009491	missense	probably benign	0.01
R5927:Col22a1	UTSW	15	72006966	missense	probably damaging	1.00
R6006:Col22a1	UTSW	15	71973836	missense	probably damaging	1.00
R6245:Col22a1	UTSW	15	71973816	missense	probably damaging	0.99
R6288:Col22a1	UTSW	15	71894869	critical splice acceptor site	probably null
R6482:Col22a1	UTSW	15	71890489	missense	possibly damaging	0.93
R6497:Col22a1	UTSW	15	71890576	missense	possibly damaging	0.85
R6579:Col22a1	UTSW	15	71881653	missense	probably benign	0.18
R6643:Col22a1	UTSW	15	71822037	splice site	probably null
R6663:Col22a1	UTSW	15	71820059	missense	unknown
R7179:Col22a1	UTSW	15	71933413	missense	unknown
R7215:Col22a1	UTSW	15	71970332	nonsense	probably null
R7216:Col22a1	UTSW	15	71973845	missense	probably damaging	1.00
R7505:Col22a1	UTSW	15	71799399	nonsense	probably null
R7585:Col22a1	UTSW	15	71892205	missense	probably damaging	0.99
R7699:Col22a1	UTSW	15	71973851	missense	probably damaging	1.00
R7788:Col22a1	UTSW	15	71952317	critical splice donor site	probably null
R7921:Col22a1	UTSW	15	71981962	splice site	probably null
R8205:Col22a1	UTSW	15	71861069	missense	unknown
R8769:Col22a1	UTSW	15	72006722	missense	probably benign	0.21
R8780:Col22a1	UTSW	15	72006947	missense	probably damaging	0.99
R8827:Col22a1	UTSW	15	71902816	critical splice donor site	probably null
R8843:Col22a1	UTSW	15	72006654	missense	probably damaging	1.00
R8982:Col22a1	UTSW	15	71973638	critical splice donor site	probably null
R9031:Col22a1	UTSW	15	71881674	nonsense	probably null
R9036:Col22a1	UTSW	15	71890582	missense	probably damaging	1.00
R9084:Col22a1	UTSW	15	71820080	missense	unknown
R9281:Col22a1	UTSW	15	71861071	missense	unknown
R9386:Col22a1	UTSW	15	71981945	missense	probably damaging	1.00
R9406:Col22a1	UTSW	15	71973692	missense	probably damaging	1.00
R9577:Col22a1	UTSW	15	71965746	missense	probably damaging	0.99
R9727:Col22a1	UTSW	15	71977274	missense	probably damaging	1.00
X0066:Col22a1	UTSW	15	71801879	missense	unknown
X0066:Col22a1	UTSW	15	71846200	missense	unknown
Y5406:Col22a1	UTSW	15	71799515	missense	unknown
Z1177:Col22a1	UTSW	15	71915120	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ACCCAGAAGTCTACAGGGTTC -3'
(R):5'- CAGTGCTTTTGACACATGCAC -3'

Sequencing Primer
(F):5'- CCAGAAGTCTACAGGGTTCTGAAAC -3'
(R):5'- GGACCTCCTGACCATGTTTAAGATG -3'

Posted On

2014-07-14