Incidental Mutation 'R0129:Notch2'
ID21551
Institutional Source Beutler Lab
Gene Symbol Notch2
Ensembl Gene ENSMUSG00000027878
Gene Namenotch 2
SynonymsN2, Motch B
MMRRC Submission 038414-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0129 (G1)
Quality Score169
Status Validated (trace)
Chromosome3
Chromosomal Location98013527-98150361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98146620 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 2200 (L2200M)
Ref Sequence ENSEMBL: ENSMUSP00000078741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079812]
Predicted Effect probably benign
Transcript: ENSMUST00000079812
AA Change: L2200M

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878
AA Change: L2200M

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 27 63 5.79e-2 SMART
EGF 67 102 1.54e-6 SMART
EGF 108 143 6.25e-7 SMART
EGF 147 180 5.28e-5 SMART
EGF_CA 182 219 6.14e-15 SMART
EGF 224 258 5.08e-7 SMART
EGF_CA 260 296 1.95e-8 SMART
EGF_CA 298 336 3.91e-8 SMART
EGF_CA 338 374 7.69e-7 SMART
EGF 378 413 6.86e-4 SMART
EGF_CA 415 454 4.15e-12 SMART
EGF_CA 456 492 3.24e-14 SMART
EGF_CA 494 530 4.77e-12 SMART
EGF_CA 532 568 2.04e-11 SMART
EGF_CA 570 605 1.18e-7 SMART
EGF_CA 607 643 7.12e-11 SMART
EGF_CA 645 680 1.82e-8 SMART
EGF_CA 682 718 1.42e-10 SMART
EGF_CA 720 755 1.25e-6 SMART
EGF_CA 757 793 3.61e-12 SMART
EGF_CA 795 831 1.53e-10 SMART
EGF 836 871 1.34e-6 SMART
EGF_CA 873 909 6.05e-14 SMART
EGF_CA 911 947 9.54e-12 SMART
EGF_CA 949 985 1.39e-13 SMART
EGF_CA 987 1023 1.26e-11 SMART
EGF_CA 1025 1061 9.31e-15 SMART
EGF 1066 1099 1.39e-4 SMART
EGF 1104 1147 2.6e-4 SMART
EGF_CA 1149 1185 1.55e-11 SMART
EGF_CA 1187 1223 2.74e-12 SMART
EGF_CA 1225 1262 4.15e-12 SMART
EGF 1267 1302 1.43e-1 SMART
EGF 1307 1343 2.33e-6 SMART
EGF 1377 1412 9.85e-5 SMART
NL 1418 1456 8.55e-19 SMART
NL 1459 1497 2.27e-14 SMART
NL 1498 1535 1.16e-11 SMART
NOD 1539 1595 3.4e-28 SMART
NODP 1619 1679 1.66e-22 SMART
transmembrane domain 1680 1702 N/A INTRINSIC
ANK 1828 1872 2.18e2 SMART
ANK 1877 1906 3.36e-2 SMART
ANK 1910 1940 1.81e2 SMART
ANK 1944 1973 6.61e-1 SMART
ANK 1977 2006 5.24e-4 SMART
ANK 2010 2039 3.41e-3 SMART
low complexity region 2179 2193 N/A INTRINSIC
low complexity region 2232 2241 N/A INTRINSIC
DUF3454 2382 2447 4.62e-30 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,787,194 D31G probably damaging Het
Actr2 A G 11: 20,100,939 probably benign Het
Adcy8 A G 15: 64,747,013 C764R probably benign Het
Ago4 A C 4: 126,517,183 F171C possibly damaging Het
Akt2 T C 7: 27,636,970 F408S probably damaging Het
Ankrd24 T C 10: 81,638,329 L26P probably damaging Het
Appl1 A T 14: 26,928,643 M524K probably damaging Het
Arhgef11 T A 3: 87,728,063 I922N probably damaging Het
Atp5h T C 11: 115,417,918 E47G probably damaging Het
Birc6 A G 17: 74,528,760 D70G probably benign Het
Bola2 G A 7: 126,696,559 V56M probably damaging Het
Ccdc151 G T 9: 21,993,552 R313S probably damaging Het
Cd300lg A G 11: 102,054,092 probably null Het
Cdc42bpb A G 12: 111,304,959 probably benign Het
Ceacam20 A G 7: 19,976,260 N403S probably damaging Het
Cenpf T C 1: 189,659,650 M662V probably benign Het
Chd3 C A 11: 69,348,501 E1607* probably null Het
Chtf18 A T 17: 25,727,311 Y9* probably null Het
Clta A G 4: 44,032,424 N200S probably benign Het
Csmd1 G A 8: 16,079,942 S1722F possibly damaging Het
Dennd4a T C 9: 64,893,294 S905P probably damaging Het
Dhx57 T C 17: 80,238,914 K1347R probably damaging Het
Dmc1 A T 15: 79,596,240 probably benign Het
Dnhd1 G T 7: 105,720,924 A4519S probably benign Het
Dnmbp A G 19: 43,850,027 C1120R probably benign Het
Efs C T 14: 54,917,223 A427T probably damaging Het
Erich6 T C 3: 58,624,378 E399G probably damaging Het
Espl1 A G 15: 102,316,648 T1431A probably benign Het
Fam184b A G 5: 45,532,778 S830P probably damaging Het
Fam49a C T 12: 12,362,349 T204I probably damaging Het
Herc1 T A 9: 66,448,075 C2203S probably damaging Het
Itpr1 G A 6: 108,349,676 V120M probably damaging Het
Kcnh7 G A 2: 62,716,159 T1026I probably benign Het
Kif1b A G 4: 149,261,201 I394T probably benign Het
Ldlrap1 A C 4: 134,757,422 V87G probably damaging Het
Lgals12 C T 19: 7,603,038 V155I probably damaging Het
Limch1 A T 5: 66,959,590 N116I probably damaging Het
Lonp2 C T 8: 86,634,890 R232C probably damaging Het
Lrch1 C A 14: 74,835,746 C151F probably benign Het
Lrig3 A G 10: 126,006,943 Y579C probably damaging Het
Macf1 T C 4: 123,433,275 S4808G probably damaging Het
Mapkap1 A T 2: 34,623,482 K501N probably damaging Het
Mdc1 G T 17: 35,854,445 R1523L probably benign Het
Mlh3 C T 12: 85,266,140 probably benign Het
Mul1 T C 4: 138,437,721 probably benign Het
Mybl2 G A 2: 163,059,491 probably benign Het
Notch1 G C 2: 26,460,458 H2223Q probably benign Het
Olfr1329 A T 4: 118,917,470 probably null Het
Olfr160 T C 9: 37,711,940 Y113C probably damaging Het
Olfr291 T A 7: 84,856,988 F206L probably benign Het
Olfr358 G A 2: 37,005,045 R190* probably null Het
Plekhs1 T C 19: 56,477,290 probably null Het
Ppm1h G A 10: 122,941,355 G509R probably damaging Het
Ppp2r3c C T 12: 55,298,422 E94K probably damaging Het
Ppp2r5e T A 12: 75,462,390 I372F probably damaging Het
Ptprt G A 2: 162,278,070 T159I probably benign Het
Rab20 A G 8: 11,454,415 F95S probably damaging Het
Rfc3 A C 5: 151,651,151 M1R probably null Het
Skp2 A G 15: 9,125,193 S100P probably damaging Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sspo A T 6: 48,455,418 T684S probably benign Het
Syt3 A G 7: 44,393,358 K355E probably damaging Het
Tcp10a A T 17: 7,343,504 K355N probably damaging Het
Tnrc18 A G 5: 142,765,045 probably benign Het
Tsfm A G 10: 127,030,470 L74P probably benign Het
Ttn G C 2: 76,734,265 N28509K probably damaging Het
Ube2l6 G A 2: 84,798,908 M1I probably null Het
Vmn2r80 T A 10: 79,169,496 H322Q probably damaging Het
Zkscan8 A T 13: 21,522,271 S212T probably benign Het
Other mutations in Notch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Notch2 APN 3 98111675 missense possibly damaging 0.77
IGL01517:Notch2 APN 3 98138655 missense probably benign 0.16
IGL01630:Notch2 APN 3 98146618 missense possibly damaging 0.77
IGL01637:Notch2 APN 3 98146060 missense probably damaging 1.00
IGL01828:Notch2 APN 3 98072613 missense probably damaging 1.00
IGL01998:Notch2 APN 3 98143106 missense probably damaging 1.00
IGL02008:Notch2 APN 3 98147296 missense probably damaging 1.00
IGL02030:Notch2 APN 3 98099421 splice site probably null
IGL02155:Notch2 APN 3 98138490 missense probably damaging 0.98
IGL02268:Notch2 APN 3 98137397 missense probably damaging 1.00
IGL02301:Notch2 APN 3 98141554 missense probably benign 0.08
IGL02336:Notch2 APN 3 98138395 missense possibly damaging 0.73
IGL02340:Notch2 APN 3 98147336 nonsense probably null
IGL02536:Notch2 APN 3 98102407 missense probably benign 0.03
IGL02589:Notch2 APN 3 98104347 critical splice acceptor site probably null
IGL02633:Notch2 APN 3 98116697 splice site probably benign
IGL02691:Notch2 APN 3 98135607 nonsense probably null
IGL02832:Notch2 APN 3 98137373 missense probably benign 0.12
IGL02894:Notch2 APN 3 98102432 nonsense probably null
IGL02902:Notch2 APN 3 98111574 missense probably damaging 1.00
IGL02967:Notch2 APN 3 98146144 missense probably damaging 0.99
IGL03015:Notch2 APN 3 98072649 missense possibly damaging 0.83
PIT4378001:Notch2 UTSW 3 98142956 missense probably damaging 1.00
PIT4519001:Notch2 UTSW 3 98098108 missense probably damaging 1.00
PIT4581001:Notch2 UTSW 3 98104462 missense probably damaging 1.00
R0111:Notch2 UTSW 3 98138761 missense probably benign 0.00
R0143:Notch2 UTSW 3 98146117 missense probably damaging 0.99
R0480:Notch2 UTSW 3 98146537 missense possibly damaging 0.88
R0523:Notch2 UTSW 3 98070970 missense probably benign 0.34
R0523:Notch2 UTSW 3 98111598 missense probably benign 0.00
R0531:Notch2 UTSW 3 98102451 splice site probably benign
R0537:Notch2 UTSW 3 98116741 missense possibly damaging 0.70
R0987:Notch2 UTSW 3 98134677 splice site probably null
R1485:Notch2 UTSW 3 98100257 missense probably benign 0.00
R1555:Notch2 UTSW 3 98131340 missense possibly damaging 0.93
R1625:Notch2 UTSW 3 98111575 missense probably damaging 1.00
R1699:Notch2 UTSW 3 98145127 missense probably damaging 1.00
R1765:Notch2 UTSW 3 98121926 missense probably damaging 1.00
R1794:Notch2 UTSW 3 98099547 missense possibly damaging 0.53
R1974:Notch2 UTSW 3 98072755 missense probably damaging 1.00
R2086:Notch2 UTSW 3 98102367 missense probably damaging 1.00
R2099:Notch2 UTSW 3 98115321 missense possibly damaging 0.79
R3778:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R3924:Notch2 UTSW 3 98122034 nonsense probably null
R4018:Notch2 UTSW 3 98104565 missense probably damaging 1.00
R4151:Notch2 UTSW 3 98147071 missense possibly damaging 0.95
R4417:Notch2 UTSW 3 98131270 missense possibly damaging 0.95
R4510:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4511:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4636:Notch2 UTSW 3 98146104 missense probably benign 0.02
R4661:Notch2 UTSW 3 98135513 missense probably damaging 1.00
R4856:Notch2 UTSW 3 98102419 missense probably damaging 1.00
R4886:Notch2 UTSW 3 98102419 missense probably damaging 1.00
R4945:Notch2 UTSW 3 98111721 missense probably benign 0.01
R4970:Notch2 UTSW 3 98101636 critical splice donor site probably null
R4974:Notch2 UTSW 3 98139633 missense probably benign 0.39
R5082:Notch2 UTSW 3 98100374 missense probably damaging 1.00
R5112:Notch2 UTSW 3 98101636 critical splice donor site probably null
R5156:Notch2 UTSW 3 98124310 missense possibly damaging 0.53
R5433:Notch2 UTSW 3 98126134 missense probably damaging 1.00
R5539:Notch2 UTSW 3 98137582 missense probably damaging 0.99
R5813:Notch2 UTSW 3 98135428 missense probably benign
R5827:Notch2 UTSW 3 98072862 missense possibly damaging 0.64
R5908:Notch2 UTSW 3 98123923 intron probably benign
R6021:Notch2 UTSW 3 98121972 missense probably damaging 1.00
R6090:Notch2 UTSW 3 98135377 nonsense probably null
R6103:Notch2 UTSW 3 98135743 missense possibly damaging 0.94
R6111:Notch2 UTSW 3 98146293 missense probably benign 0.00
R6168:Notch2 UTSW 3 98145217 missense probably damaging 1.00
R6382:Notch2 UTSW 3 98141543 missense probably damaging 1.00
R6404:Notch2 UTSW 3 98081998 missense probably damaging 1.00
R6419:Notch2 UTSW 3 98100389 critical splice donor site probably null
R6454:Notch2 UTSW 3 98137406 missense possibly damaging 0.47
R6626:Notch2 UTSW 3 98101605 missense probably damaging 1.00
R6629:Notch2 UTSW 3 98120881 missense possibly damaging 0.65
R6706:Notch2 UTSW 3 98138430 missense possibly damaging 0.94
R6735:Notch2 UTSW 3 98134586 missense probably damaging 1.00
R6837:Notch2 UTSW 3 98070854 splice site probably null
R7021:Notch2 UTSW 3 98135446 missense probably benign
R7028:Notch2 UTSW 3 98102387 missense probably damaging 1.00
R7228:Notch2 UTSW 3 98137317 nonsense probably null
R7320:Notch2 UTSW 3 98131327 missense possibly damaging 0.94
R7361:Notch2 UTSW 3 98131402 missense probably benign 0.04
R7562:Notch2 UTSW 3 98113114 missense probably damaging 1.00
R7630:Notch2 UTSW 3 98137508 missense possibly damaging 0.65
R7637:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R7748:Notch2 UTSW 3 98138484 missense possibly damaging 0.69
R7764:Notch2 UTSW 3 98142988 missense probably damaging 1.00
R7817:Notch2 UTSW 3 98107127 missense probably damaging 1.00
R7952:Notch2 UTSW 3 98100236 missense probably benign 0.30
R8136:Notch2 UTSW 3 98124221 missense probably damaging 1.00
R8159:Notch2 UTSW 3 98120922 missense possibly damaging 0.95
R8679:Notch2 UTSW 3 98121902 critical splice acceptor site probably null
R8879:Notch2 UTSW 3 98135599 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GTCTTTCCTCAGTCTGAAGCACACC -3'
(R):5'- GGAACTGGATGTAACCTGCCCAAG -3'

Sequencing Primer
(F):5'- TGCCTAACCTTGCCAAGGAG -3'
(R):5'- ATGTAACCTGCCCAAGCTTCC -3'
Posted On2013-04-11