Incidental Mutation 'R1932:Crygs'
ID 215512
Institutional Source Beutler Lab
Gene Symbol Crygs
Ensembl Gene ENSMUSG00000033501
Gene Name crystallin, gamma S
Synonyms Opj
MMRRC Submission 039950-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1932 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 22623953-22630160 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22625304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 46 (T46S)
Ref Sequence ENSEMBL: ENSMUSP00000043588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040592]
AlphaFold O35486
PDB Structure NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000040592
AA Change: T46S

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: T46S

DomainStartEndE-ValueType
XTALbg 7 86 5.98e-40 SMART
XTALbg 95 176 6.26e-43 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,190,691 (GRCm39) Q278H probably benign Het
Ace3 T C 11: 105,895,436 (GRCm39) probably null Het
Aco1 T C 4: 40,176,499 (GRCm39) V221A probably damaging Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamts8 A G 9: 30,867,808 (GRCm39) D544G probably benign Het
Angptl4 C A 17: 34,000,249 (GRCm39) E40* probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atf7ip2 T A 16: 10,059,567 (GRCm39) I369N possibly damaging Het
Atp6ap1l T A 13: 91,031,806 (GRCm39) Y292F probably damaging Het
Atp6v1b2 A T 8: 69,555,459 (GRCm39) K217* probably null Het
Bid C T 6: 120,874,216 (GRCm39) A110T possibly damaging Het
Blvra T A 2: 126,937,068 (GRCm39) W174R probably damaging Het
Catsperg1 C T 7: 28,897,568 (GRCm39) G239R probably damaging Het
Ccdc157 G T 11: 4,096,549 (GRCm39) A400D probably damaging Het
Chd2 G T 7: 73,104,193 (GRCm39) P1298T probably damaging Het
CK137956 G A 4: 127,840,651 (GRCm39) L352F possibly damaging Het
Col22a1 G A 15: 71,741,989 (GRCm39) P503S unknown Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Crem C T 18: 3,299,284 (GRCm39) G47R probably benign Het
Cts8 T A 13: 61,401,429 (GRCm39) H62L probably damaging Het
Cyp4a32 T A 4: 115,468,474 (GRCm39) F319I possibly damaging Het
Dchs1 T C 7: 105,415,109 (GRCm39) S692G probably damaging Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Defa29 A T 8: 21,816,865 (GRCm39) S43T probably damaging Het
Dnajc14 A G 10: 128,652,661 (GRCm39) D573G probably damaging Het
Drd5 A G 5: 38,477,319 (GRCm39) Y104C probably benign Het
Efcab7 C T 4: 99,768,215 (GRCm39) P102L probably damaging Het
Efhc1 A G 1: 21,037,624 (GRCm39) Y267C probably damaging Het
Eif2ak4 T C 2: 118,278,967 (GRCm39) Y243H probably damaging Het
Gfm2 T A 13: 97,278,475 (GRCm39) I7N probably damaging Het
Gmds A G 13: 32,311,980 (GRCm39) F150L possibly damaging Het
Gp2 T C 7: 119,053,455 (GRCm39) T169A possibly damaging Het
Grb14 A G 2: 64,743,146 (GRCm39) F508L probably damaging Het
Hdac5 T A 11: 102,086,698 (GRCm39) probably benign Het
Heatr1 T A 13: 12,450,066 (GRCm39) M620K probably damaging Het
Herc3 A G 6: 58,853,778 (GRCm39) E608G probably damaging Het
Hoxb4 T C 11: 96,210,867 (GRCm39) Y156H probably damaging Het
Ifi205 T A 1: 173,855,980 (GRCm39) I17F possibly damaging Het
Il2rb A T 15: 78,375,977 (GRCm39) S25T possibly damaging Het
Kansl1 T C 11: 104,225,923 (GRCm39) T998A probably damaging Het
Kcna6 G T 6: 126,715,451 (GRCm39) H479Q probably benign Het
Kif2a T C 13: 107,114,599 (GRCm39) K350R probably benign Het
Lct G T 1: 128,221,898 (GRCm39) A1547E probably damaging Het
Lhx9 T A 1: 138,769,747 (GRCm39) probably benign Het
Lingo1 T A 9: 56,526,934 (GRCm39) I552F possibly damaging Het
Lrp4 G A 2: 91,327,700 (GRCm39) W1516* probably null Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Ltbp1 T A 17: 75,620,029 (GRCm39) D719E probably benign Het
Ltbp4 A G 7: 27,007,191 (GRCm39) probably null Het
Macf1 A G 4: 123,345,830 (GRCm39) I1326T probably damaging Het
Manba T C 3: 135,250,501 (GRCm39) F376S probably benign Het
Mink1 T C 11: 70,499,254 (GRCm39) probably null Het
Nfatc2ip C T 7: 125,984,164 (GRCm39) V410I probably damaging Het
Nlrp1b A T 11: 71,072,964 (GRCm39) I293N probably damaging Het
Or10aa3 T C 1: 173,878,244 (GRCm39) Y102H probably damaging Het
Otol1 A C 3: 69,935,437 (GRCm39) E476D probably benign Het
Pcdhb4 C T 18: 37,442,594 (GRCm39) P635S probably benign Het
Pfkfb4 T A 9: 108,828,237 (GRCm39) F91I probably damaging Het
Polq G A 16: 36,882,666 (GRCm39) R1610Q possibly damaging Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Ppp1r15b C T 1: 133,059,363 (GRCm39) probably benign Het
Prkca T G 11: 108,082,975 (GRCm39) D90A probably benign Het
Sall3 T C 18: 81,012,968 (GRCm39) D1156G probably benign Het
Scn7a A T 2: 66,506,446 (GRCm39) L1481H probably damaging Het
Selenon A T 4: 134,271,929 (GRCm39) I292N probably damaging Het
Sema6d T A 2: 124,501,806 (GRCm39) probably null Het
Sgpp1 G T 12: 75,762,953 (GRCm39) Y409* probably null Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc25a13 A G 6: 6,042,264 (GRCm39) V638A probably benign Het
Snhg11 T C 2: 158,218,746 (GRCm39) probably benign Het
Sorbs2 A G 8: 46,249,389 (GRCm39) Q800R probably benign Het
Srf C A 17: 46,860,912 (GRCm39) G401C probably damaging Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Swap70 C T 7: 109,878,470 (GRCm39) A480V possibly damaging Het
Sycp2 A G 2: 178,023,750 (GRCm39) V422A probably damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tet3 T C 6: 83,381,361 (GRCm39) N269S possibly damaging Het
Thap12 A T 7: 98,366,045 (GRCm39) I738F possibly damaging Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmem229a A T 6: 24,955,010 (GRCm39) F248Y probably damaging Het
Tmprss7 G A 16: 45,504,956 (GRCm39) Q145* probably null Het
Tnc A T 4: 63,911,262 (GRCm39) probably null Het
Tonsl A T 15: 76,508,797 (GRCm39) Y21N probably damaging Het
Tpr A G 1: 150,297,414 (GRCm39) D1009G probably benign Het
Trpm2 G A 10: 77,776,992 (GRCm39) A435V probably damaging Het
Ubr3 T A 2: 69,783,820 (GRCm39) probably null Het
Vcan T C 13: 89,853,653 (GRCm39) N436D possibly damaging Het
Vmn2r104 T A 17: 20,261,031 (GRCm39) Y464F probably damaging Het
Vmn2r44 T A 7: 8,370,981 (GRCm39) R688S probably benign Het
Wdr74 G T 19: 8,715,311 (GRCm39) V157L probably benign Het
Wnt7a T A 6: 91,371,530 (GRCm39) D144V probably benign Het
Zfp106 C T 2: 120,362,162 (GRCm39) A986T possibly damaging Het
Other mutations in Crygs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Crygs APN 16 22,625,312 (GRCm39) missense possibly damaging 0.81
R1694:Crygs UTSW 16 22,625,425 (GRCm39) splice site probably null
R2206:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2207:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2275:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2298:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2299:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2300:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2326:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2329:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2330:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2331:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2332:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2857:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2895:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2896:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2921:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R2922:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3120:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3196:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3427:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3609:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3611:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3625:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3693:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3694:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3695:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3870:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3871:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R3876:Crygs UTSW 16 22,625,262 (GRCm39) missense probably damaging 1.00
R4052:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R4207:Crygs UTSW 16 22,624,301 (GRCm39) missense possibly damaging 0.93
R4299:Crygs UTSW 16 22,624,161 (GRCm39) nonsense probably null
R4630:Crygs UTSW 16 22,624,268 (GRCm39) missense possibly damaging 0.90
R7392:Crygs UTSW 16 22,625,252 (GRCm39) missense probably benign 0.35
R7573:Crygs UTSW 16 22,624,069 (GRCm39) makesense probably null
R7954:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R7955:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R7957:Crygs UTSW 16 22,624,082 (GRCm39) missense probably damaging 1.00
R8172:Crygs UTSW 16 22,625,292 (GRCm39) missense probably damaging 1.00
R9653:Crygs UTSW 16 22,625,304 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GTGCTACACAGAGAAACCCTG -3'
(R):5'- TTATCTGTGTGCAAAGCCGC -3'

Sequencing Primer
(F):5'- GCTACACAGAGAAACCCTGTCTCG -3'
(R):5'- GCAAAGCCGCCCAGCTC -3'
Posted On 2014-07-14