Incidental Mutation 'R1932:Srf'
ID215519
Institutional Source Beutler Lab
Gene Symbol Srf
Ensembl Gene ENSMUSG00000015605
Gene Nameserum response factor
Synonyms
MMRRC Submission 039950-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1932 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46546839-46556162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46549986 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 401 (G401C)
Ref Sequence ENSEMBL: ENSMUSP00000015749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015749] [ENSMUST00000066026] [ENSMUST00000182485]
Predicted Effect probably damaging
Transcript: ENSMUST00000015749
AA Change: G401C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015749
Gene: ENSMUSG00000015605
AA Change: G401C

DomainStartEndE-ValueType
low complexity region 6 46 N/A INTRINSIC
low complexity region 60 70 N/A INTRINSIC
low complexity region 73 90 N/A INTRINSIC
low complexity region 104 130 N/A INTRINSIC
MADS 137 196 3.08e-28 SMART
low complexity region 217 229 N/A INTRINSIC
Blast:MADS 256 289 3e-11 BLAST
low complexity region 300 314 N/A INTRINSIC
internal_repeat_1 335 360 6.39e-6 PROSPERO
low complexity region 368 383 N/A INTRINSIC
internal_repeat_1 450 473 6.39e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000066026
SMART Domains Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 441 1e-35 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 2e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
low complexity region 2503 2520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182315
Predicted Effect probably benign
Transcript: ENSMUST00000182485
SMART Domains Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 442 1.4e-33 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 3e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
coiled coil region 2461 2497 N/A INTRINSIC
low complexity region 2513 2530 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199897
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous nuclear protein that stimulates both cell proliferation and differentiation. It is a member of the MADS (MCM1, Agamous, Deficiens, and SRF) box superfamily of transcription factors. This protein binds to the serum response element (SRE) in the promoter region of target genes. This protein regulates the activity of many immediate-early genes, for example c-fos, and thereby participates in cell cycle regulation, apoptosis, cell growth, and cell differentiation. This gene is the downstream target of many pathways; for example, the mitogen-activated protein kinase pathway (MAPK) that acts through the ternary complex factors (TCFs). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit embryonic lethality, abnormal gastrulation, no mesoderm or primitive streak formation and reduced embryo size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,279,394 Q278H probably benign Het
Ace3 T C 11: 106,004,610 probably null Het
Aco1 T C 4: 40,176,499 V221A probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamts8 A G 9: 30,956,512 D544G probably benign Het
Angptl4 C A 17: 33,781,275 E40* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip2 T A 16: 10,241,703 I369N possibly damaging Het
Atp6ap1l T A 13: 90,883,687 Y292F probably damaging Het
Atp6v1b2 A T 8: 69,102,807 K217* probably null Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Blvra T A 2: 127,095,148 W174R probably damaging Het
Catsperg1 C T 7: 29,198,143 G239R probably damaging Het
Ccdc157 G T 11: 4,146,549 A400D probably damaging Het
Chd2 G T 7: 73,454,445 P1298T probably damaging Het
CK137956 G A 4: 127,946,858 L352F possibly damaging Het
Col22a1 G A 15: 71,870,140 P503S unknown Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Crem C T 18: 3,299,284 G47R probably benign Het
Crygs T A 16: 22,806,554 T46S probably benign Het
Cts8 T A 13: 61,253,615 H62L probably damaging Het
Cyp4a32 T A 4: 115,611,277 F319I possibly damaging Het
Dchs1 T C 7: 105,765,902 S692G probably damaging Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Defa29 A T 8: 21,326,849 S43T probably damaging Het
Dnajc14 A G 10: 128,816,792 D573G probably damaging Het
Drd5 A G 5: 38,319,976 Y104C probably benign Het
Efcab7 C T 4: 99,911,018 P102L probably damaging Het
Efhc1 A G 1: 20,967,400 Y267C probably damaging Het
Eif2ak4 T C 2: 118,448,486 Y243H probably damaging Het
Gfm2 T A 13: 97,141,967 I7N probably damaging Het
Gmds A G 13: 32,127,997 F150L possibly damaging Het
Gp2 T C 7: 119,454,232 T169A possibly damaging Het
Grb14 A G 2: 64,912,802 F508L probably damaging Het
Hdac5 T A 11: 102,195,872 probably benign Het
Heatr1 T A 13: 12,435,185 M620K probably damaging Het
Herc3 A G 6: 58,876,793 E608G probably damaging Het
Hoxb4 T C 11: 96,320,041 Y156H probably damaging Het
Ifi205 T A 1: 174,028,414 I17F possibly damaging Het
Il2rb A T 15: 78,491,777 S25T possibly damaging Het
Kansl1 T C 11: 104,335,097 T998A probably damaging Het
Kcna6 G T 6: 126,738,488 H479Q probably benign Het
Kif2a T C 13: 106,978,091 K350R probably benign Het
Lct G T 1: 128,294,161 A1547E probably damaging Het
Lhx9 T A 1: 138,842,009 probably benign Het
Lingo1 T A 9: 56,619,650 I552F possibly damaging Het
Lrp4 G A 2: 91,497,355 W1516* probably null Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Ltbp1 T A 17: 75,313,034 D719E probably benign Het
Ltbp4 A G 7: 27,307,766 probably null Het
Macf1 A G 4: 123,452,037 I1326T probably damaging Het
Manba T C 3: 135,544,740 F376S probably benign Het
Mink1 T C 11: 70,608,428 probably null Het
Nfatc2ip C T 7: 126,384,992 V410I probably damaging Het
Nlrp1b A T 11: 71,182,138 I293N probably damaging Het
Olfr432 T C 1: 174,050,678 Y102H probably damaging Het
Otol1 A C 3: 70,028,104 E476D probably benign Het
Pcdhb4 C T 18: 37,309,541 P635S probably benign Het
Pfkfb4 T A 9: 108,999,169 F91I probably damaging Het
Polq G A 16: 37,062,304 R1610Q possibly damaging Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Ppp1r15b C T 1: 133,131,625 probably benign Het
Prkca T G 11: 108,192,149 D90A probably benign Het
Sall3 T C 18: 80,969,753 D1156G probably benign Het
Scn7a A T 2: 66,676,102 L1481H probably damaging Het
Selenon A T 4: 134,544,618 I292N probably damaging Het
Sema6d T A 2: 124,659,886 probably null Het
Sgpp1 G T 12: 75,716,179 Y409* probably null Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc25a13 A G 6: 6,042,264 V638A probably benign Het
Snhg11 T C 2: 158,376,826 probably benign Het
Sorbs2 A G 8: 45,796,352 Q800R probably benign Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Swap70 C T 7: 110,279,263 A480V possibly damaging Het
Sycp2 A G 2: 178,381,957 V422A probably damaging Het
Taf4 G A 2: 179,932,029 T682M probably damaging Het
Tet3 T C 6: 83,404,379 N269S possibly damaging Het
Thap12 A T 7: 98,716,838 I738F possibly damaging Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmem229a A T 6: 24,955,011 F248Y probably damaging Het
Tmprss7 G A 16: 45,684,593 Q145* probably null Het
Tnc A T 4: 63,993,025 probably null Het
Tonsl A T 15: 76,624,597 Y21N probably damaging Het
Tpr A G 1: 150,421,663 D1009G probably benign Het
Trpm2 G A 10: 77,941,158 A435V probably damaging Het
Ubr3 T A 2: 69,953,476 probably null Het
Vcan T C 13: 89,705,534 N436D possibly damaging Het
Vmn2r104 T A 17: 20,040,769 Y464F probably damaging Het
Vmn2r44 T A 7: 8,367,982 R688S probably benign Het
Wdr74 G T 19: 8,737,947 V157L probably benign Het
Wnt7a T A 6: 91,394,548 D144V probably benign Het
Zfp106 C T 2: 120,531,681 A986T possibly damaging Het
Other mutations in Srf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01836:Srf APN 17 46549182 unclassified probably benign
IGL02448:Srf APN 17 46555423 missense possibly damaging 0.47
R0277:Srf UTSW 17 46549489 missense possibly damaging 0.54
R0323:Srf UTSW 17 46549489 missense possibly damaging 0.54
R1633:Srf UTSW 17 46551608 missense probably damaging 1.00
R1807:Srf UTSW 17 46553759 missense possibly damaging 0.88
R1930:Srf UTSW 17 46549986 missense probably damaging 1.00
R1951:Srf UTSW 17 46551707 missense possibly damaging 0.94
R4851:Srf UTSW 17 46549474 missense probably benign 0.33
R7017:Srf UTSW 17 46550904 missense probably benign 0.18
R7128:Srf UTSW 17 46555446 missense possibly damaging 0.88
R7177:Srf UTSW 17 46555392 missense probably damaging 0.99
R7315:Srf UTSW 17 46551794 critical splice acceptor site probably null
R8019:Srf UTSW 17 46555822 missense unknown
R8678:Srf UTSW 17 46550899 critical splice donor site probably null
R8928:Srf UTSW 17 46549169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGTCCTTCTTGCTTCAGC -3'
(R):5'- ATCCCACCGTAGAACAGTGG -3'

Sequencing Primer
(F):5'- TTGCTTCAGCCCTGCCC -3'
(R):5'- AGACTTTATTGTTGTTGACAGGAAGC -3'
Posted On2014-07-14