Incidental Mutation 'R1932:Ltbp1'
ID 215520
Institutional Source Beutler Lab
Gene Symbol Ltbp1
Ensembl Gene ENSMUSG00000001870
Gene Name latent transforming growth factor beta binding protein 1
Synonyms 9430031G15Rik, Ltbp1L, b2b1000Clo, LTBP-1
MMRRC Submission 039950-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1932 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 75312563-75699507 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75620029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 719 (D719E)
Ref Sequence ENSEMBL: ENSMUSP00000108133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001927] [ENSMUST00000112514] [ENSMUST00000112516] [ENSMUST00000135447]
AlphaFold Q8CG19
Predicted Effect probably benign
Transcript: ENSMUST00000001927
AA Change: D1090E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001927
Gene: ENSMUSG00000001870
AA Change: D1090E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 34 49 N/A INTRINSIC
low complexity region 58 73 N/A INTRINSIC
low complexity region 94 109 N/A INTRINSIC
low complexity region 149 158 N/A INTRINSIC
EGF 184 213 9.27e-1 SMART
EGF 394 423 2.23e-3 SMART
Pfam:TB 559 601 2.4e-9 PFAM
EGF_CA 618 658 9.39e-11 SMART
Pfam:TB 680 720 1e-18 PFAM
low complexity region 839 849 N/A INTRINSIC
EGF_CA 865 906 5.83e-7 SMART
EGF_CA 907 948 6.39e-13 SMART
EGF_CA 949 989 4.25e-9 SMART
EGF_CA 990 1029 2.44e-9 SMART
EGF_CA 1030 1070 5.87e-12 SMART
EGF_CA 1071 1111 3.61e-12 SMART
EGF_CA 1112 1152 1.57e-12 SMART
EGF_CA 1153 1193 1.75e-10 SMART
EGF_CA 1194 1235 6.74e-12 SMART
EGF_CA 1236 1277 3.22e-9 SMART
EGF 1281 1320 2.16e1 SMART
Pfam:TB 1349 1391 5.6e-17 PFAM
EGF 1418 1457 1.14e0 SMART
EGF_CA 1458 1498 2.68e-6 SMART
Pfam:TB 1526 1567 4.2e-15 PFAM
EGF 1615 1652 1e-5 SMART
EGF_CA 1653 1697 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112514
AA Change: D719E

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108133
Gene: ENSMUSG00000001870
AA Change: D719E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.5e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 400 3.1e-17 PFAM
low complexity region 468 478 N/A INTRINSIC
EGF_CA 494 535 5.83e-7 SMART
EGF_CA 536 577 6.39e-13 SMART
EGF_CA 578 618 4.25e-9 SMART
EGF_CA 619 658 2.44e-9 SMART
EGF_CA 659 699 5.87e-12 SMART
EGF_CA 700 740 3.61e-12 SMART
EGF_CA 741 781 1.57e-12 SMART
EGF_CA 782 822 1.75e-10 SMART
EGF_CA 823 864 6.74e-12 SMART
EGF_CA 865 906 3.22e-9 SMART
EGF 910 949 2.16e1 SMART
Pfam:TB 977 1020 4.3e-20 PFAM
EGF 1047 1086 1.14e0 SMART
EGF_CA 1087 1127 2.68e-6 SMART
Pfam:TB 1154 1196 1.3e-17 PFAM
EGF 1244 1281 1e-5 SMART
EGF_CA 1282 1326 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112516
AA Change: D772E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108135
Gene: ENSMUSG00000001870
AA Change: D772E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 2.23e-3 SMART
Pfam:TB 240 283 9.9e-13 PFAM
EGF_CA 300 340 9.39e-11 SMART
Pfam:TB 361 402 7.6e-20 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 5.83e-7 SMART
EGF_CA 589 630 6.39e-13 SMART
EGF_CA 631 671 4.25e-9 SMART
EGF_CA 672 711 2.44e-9 SMART
EGF_CA 712 752 5.87e-12 SMART
EGF_CA 753 793 3.61e-12 SMART
EGF_CA 794 834 1.57e-12 SMART
EGF_CA 835 875 1.75e-10 SMART
EGF_CA 876 917 6.74e-12 SMART
EGF_CA 918 959 3.22e-9 SMART
EGF 963 1002 2.16e1 SMART
Pfam:TB 1030 1073 4.5e-20 PFAM
EGF 1100 1139 1.14e0 SMART
EGF_CA 1140 1180 2.68e-6 SMART
Pfam:TB 1207 1249 1.4e-17 PFAM
EGF 1297 1334 1e-5 SMART
EGF_CA 1335 1379 5.11e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135447
AA Change: D772E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116890
Gene: ENSMUSG00000001870
AA Change: D772E

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 76 105 1.1e-5 SMART
Pfam:TB 240 283 4.3e-10 PFAM
EGF_CA 300 340 4.4e-13 SMART
Pfam:TB 361 402 3.3e-17 PFAM
low complexity region 521 531 N/A INTRINSIC
EGF_CA 547 588 2.9e-9 SMART
EGF_CA 589 630 3e-15 SMART
EGF_CA 631 671 2.1e-11 SMART
EGF_CA 672 711 1.2e-11 SMART
EGF_CA 712 752 2.8e-14 SMART
EGF_CA 753 793 1.8e-14 SMART
EGF_CA 794 834 7.5e-15 SMART
EGF_CA 835 875 8.4e-13 SMART
EGF_CA 876 917 3.2e-14 SMART
EGF_CA 918 959 1.6e-11 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of latent TGF-beta binding proteins (LTBPs). The secretion and activation of TGF-betas is regulated by their association with latency-associated proteins and with latent TGF-beta binding proteins. The product of this gene targets latent complexes of transforming growth factor beta to the extracellular matrix, where the latent cytokine is subsequently activated by several different mechanisms. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality associated with defects in the aortic arch and outflow tract. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T A 9: 44,190,691 (GRCm39) Q278H probably benign Het
Ace3 T C 11: 105,895,436 (GRCm39) probably null Het
Aco1 T C 4: 40,176,499 (GRCm39) V221A probably damaging Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamts8 A G 9: 30,867,808 (GRCm39) D544G probably benign Het
Angptl4 C A 17: 34,000,249 (GRCm39) E40* probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atf7ip2 T A 16: 10,059,567 (GRCm39) I369N possibly damaging Het
Atp6ap1l T A 13: 91,031,806 (GRCm39) Y292F probably damaging Het
Atp6v1b2 A T 8: 69,555,459 (GRCm39) K217* probably null Het
Bid C T 6: 120,874,216 (GRCm39) A110T possibly damaging Het
Blvra T A 2: 126,937,068 (GRCm39) W174R probably damaging Het
Catsperg1 C T 7: 28,897,568 (GRCm39) G239R probably damaging Het
Ccdc157 G T 11: 4,096,549 (GRCm39) A400D probably damaging Het
Chd2 G T 7: 73,104,193 (GRCm39) P1298T probably damaging Het
CK137956 G A 4: 127,840,651 (GRCm39) L352F possibly damaging Het
Col22a1 G A 15: 71,741,989 (GRCm39) P503S unknown Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Crem C T 18: 3,299,284 (GRCm39) G47R probably benign Het
Crygs T A 16: 22,625,304 (GRCm39) T46S probably benign Het
Cts8 T A 13: 61,401,429 (GRCm39) H62L probably damaging Het
Cyp4a32 T A 4: 115,468,474 (GRCm39) F319I possibly damaging Het
Dchs1 T C 7: 105,415,109 (GRCm39) S692G probably damaging Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Defa29 A T 8: 21,816,865 (GRCm39) S43T probably damaging Het
Dnajc14 A G 10: 128,652,661 (GRCm39) D573G probably damaging Het
Drd5 A G 5: 38,477,319 (GRCm39) Y104C probably benign Het
Efcab7 C T 4: 99,768,215 (GRCm39) P102L probably damaging Het
Efhc1 A G 1: 21,037,624 (GRCm39) Y267C probably damaging Het
Eif2ak4 T C 2: 118,278,967 (GRCm39) Y243H probably damaging Het
Gfm2 T A 13: 97,278,475 (GRCm39) I7N probably damaging Het
Gmds A G 13: 32,311,980 (GRCm39) F150L possibly damaging Het
Gp2 T C 7: 119,053,455 (GRCm39) T169A possibly damaging Het
Grb14 A G 2: 64,743,146 (GRCm39) F508L probably damaging Het
Hdac5 T A 11: 102,086,698 (GRCm39) probably benign Het
Heatr1 T A 13: 12,450,066 (GRCm39) M620K probably damaging Het
Herc3 A G 6: 58,853,778 (GRCm39) E608G probably damaging Het
Hoxb4 T C 11: 96,210,867 (GRCm39) Y156H probably damaging Het
Ifi205 T A 1: 173,855,980 (GRCm39) I17F possibly damaging Het
Il2rb A T 15: 78,375,977 (GRCm39) S25T possibly damaging Het
Kansl1 T C 11: 104,225,923 (GRCm39) T998A probably damaging Het
Kcna6 G T 6: 126,715,451 (GRCm39) H479Q probably benign Het
Kif2a T C 13: 107,114,599 (GRCm39) K350R probably benign Het
Lct G T 1: 128,221,898 (GRCm39) A1547E probably damaging Het
Lhx9 T A 1: 138,769,747 (GRCm39) probably benign Het
Lingo1 T A 9: 56,526,934 (GRCm39) I552F possibly damaging Het
Lrp4 G A 2: 91,327,700 (GRCm39) W1516* probably null Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Ltbp4 A G 7: 27,007,191 (GRCm39) probably null Het
Macf1 A G 4: 123,345,830 (GRCm39) I1326T probably damaging Het
Manba T C 3: 135,250,501 (GRCm39) F376S probably benign Het
Mink1 T C 11: 70,499,254 (GRCm39) probably null Het
Nfatc2ip C T 7: 125,984,164 (GRCm39) V410I probably damaging Het
Nlrp1b A T 11: 71,072,964 (GRCm39) I293N probably damaging Het
Or10aa3 T C 1: 173,878,244 (GRCm39) Y102H probably damaging Het
Otol1 A C 3: 69,935,437 (GRCm39) E476D probably benign Het
Pcdhb4 C T 18: 37,442,594 (GRCm39) P635S probably benign Het
Pfkfb4 T A 9: 108,828,237 (GRCm39) F91I probably damaging Het
Polq G A 16: 36,882,666 (GRCm39) R1610Q possibly damaging Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Ppp1r15b C T 1: 133,059,363 (GRCm39) probably benign Het
Prkca T G 11: 108,082,975 (GRCm39) D90A probably benign Het
Sall3 T C 18: 81,012,968 (GRCm39) D1156G probably benign Het
Scn7a A T 2: 66,506,446 (GRCm39) L1481H probably damaging Het
Selenon A T 4: 134,271,929 (GRCm39) I292N probably damaging Het
Sema6d T A 2: 124,501,806 (GRCm39) probably null Het
Sgpp1 G T 12: 75,762,953 (GRCm39) Y409* probably null Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc25a13 A G 6: 6,042,264 (GRCm39) V638A probably benign Het
Snhg11 T C 2: 158,218,746 (GRCm39) probably benign Het
Sorbs2 A G 8: 46,249,389 (GRCm39) Q800R probably benign Het
Srf C A 17: 46,860,912 (GRCm39) G401C probably damaging Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Swap70 C T 7: 109,878,470 (GRCm39) A480V possibly damaging Het
Sycp2 A G 2: 178,023,750 (GRCm39) V422A probably damaging Het
Taf4 G A 2: 179,573,822 (GRCm39) T682M probably damaging Het
Tet3 T C 6: 83,381,361 (GRCm39) N269S possibly damaging Het
Thap12 A T 7: 98,366,045 (GRCm39) I738F possibly damaging Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmem229a A T 6: 24,955,010 (GRCm39) F248Y probably damaging Het
Tmprss7 G A 16: 45,504,956 (GRCm39) Q145* probably null Het
Tnc A T 4: 63,911,262 (GRCm39) probably null Het
Tonsl A T 15: 76,508,797 (GRCm39) Y21N probably damaging Het
Tpr A G 1: 150,297,414 (GRCm39) D1009G probably benign Het
Trpm2 G A 10: 77,776,992 (GRCm39) A435V probably damaging Het
Ubr3 T A 2: 69,783,820 (GRCm39) probably null Het
Vcan T C 13: 89,853,653 (GRCm39) N436D possibly damaging Het
Vmn2r104 T A 17: 20,261,031 (GRCm39) Y464F probably damaging Het
Vmn2r44 T A 7: 8,370,981 (GRCm39) R688S probably benign Het
Wdr74 G T 19: 8,715,311 (GRCm39) V157L probably benign Het
Wnt7a T A 6: 91,371,530 (GRCm39) D144V probably benign Het
Zfp106 C T 2: 120,362,162 (GRCm39) A986T possibly damaging Het
Other mutations in Ltbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ltbp1 APN 17 75,532,333 (GRCm39) missense probably damaging 1.00
IGL00156:Ltbp1 APN 17 75,692,155 (GRCm39) missense probably damaging 0.97
IGL00161:Ltbp1 APN 17 75,617,147 (GRCm39) splice site probably benign
IGL00771:Ltbp1 APN 17 75,669,511 (GRCm39) missense probably damaging 1.00
IGL00822:Ltbp1 APN 17 75,458,316 (GRCm39) missense probably damaging 1.00
IGL01760:Ltbp1 APN 17 75,534,145 (GRCm39) missense probably damaging 0.97
IGL01796:Ltbp1 APN 17 75,534,240 (GRCm39) splice site probably benign
IGL01826:Ltbp1 APN 17 75,599,835 (GRCm39) missense possibly damaging 0.67
IGL02372:Ltbp1 APN 17 75,559,401 (GRCm39) missense probably damaging 0.99
IGL02792:Ltbp1 APN 17 75,589,989 (GRCm39) missense probably damaging 1.00
IGL02862:Ltbp1 APN 17 75,697,466 (GRCm39) missense probably damaging 1.00
IGL03095:Ltbp1 APN 17 75,589,413 (GRCm39) missense possibly damaging 0.67
IGL03345:Ltbp1 APN 17 75,373,154 (GRCm39) missense probably damaging 0.99
IGL03404:Ltbp1 APN 17 75,532,301 (GRCm39) missense probably damaging 0.97
Hiphop UTSW 17 75,666,452 (GRCm39) missense probably damaging 0.99
Pygea UTSW 17 75,634,223 (GRCm39) nonsense probably null
Twist UTSW 17 75,617,217 (GRCm39) missense probably damaging 0.99
R0010:Ltbp1 UTSW 17 75,670,386 (GRCm39) missense probably damaging 1.00
R0010:Ltbp1 UTSW 17 75,670,386 (GRCm39) missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75,671,355 (GRCm39) missense probably damaging 1.00
R0022:Ltbp1 UTSW 17 75,671,355 (GRCm39) missense probably damaging 1.00
R0033:Ltbp1 UTSW 17 75,583,504 (GRCm39) missense possibly damaging 0.66
R0033:Ltbp1 UTSW 17 75,583,504 (GRCm39) missense possibly damaging 0.66
R0034:Ltbp1 UTSW 17 75,354,563 (GRCm39) intron probably benign
R0068:Ltbp1 UTSW 17 75,666,404 (GRCm39) missense probably damaging 1.00
R0068:Ltbp1 UTSW 17 75,666,404 (GRCm39) missense probably damaging 1.00
R0467:Ltbp1 UTSW 17 75,589,424 (GRCm39) critical splice donor site probably null
R0554:Ltbp1 UTSW 17 75,532,274 (GRCm39) missense probably damaging 0.99
R0584:Ltbp1 UTSW 17 75,670,467 (GRCm39) missense probably damaging 1.00
R0863:Ltbp1 UTSW 17 75,559,381 (GRCm39) missense probably damaging 1.00
R0991:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1084:Ltbp1 UTSW 17 75,666,420 (GRCm39) nonsense probably null
R1114:Ltbp1 UTSW 17 75,667,770 (GRCm39) missense probably benign
R1177:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1179:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1195:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1245:Ltbp1 UTSW 17 75,634,189 (GRCm39) splice site probably benign
R1246:Ltbp1 UTSW 17 75,692,156 (GRCm39) nonsense probably null
R1258:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1259:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1260:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1262:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1265:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1267:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1269:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1272:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1411:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1579:Ltbp1 UTSW 17 75,559,362 (GRCm39) missense probably benign 0.00
R1694:Ltbp1 UTSW 17 75,532,280 (GRCm39) missense possibly damaging 0.75
R1705:Ltbp1 UTSW 17 75,692,196 (GRCm39) splice site probably null
R1716:Ltbp1 UTSW 17 75,622,019 (GRCm39) missense probably benign 0.08
R1815:Ltbp1 UTSW 17 75,559,375 (GRCm39) missense probably benign 0.00
R1951:Ltbp1 UTSW 17 75,458,372 (GRCm39) missense probably benign 0.00
R2044:Ltbp1 UTSW 17 75,583,427 (GRCm39) missense probably damaging 1.00
R2118:Ltbp1 UTSW 17 75,617,154 (GRCm39) missense possibly damaging 0.52
R2120:Ltbp1 UTSW 17 75,617,154 (GRCm39) missense possibly damaging 0.52
R2121:Ltbp1 UTSW 17 75,617,154 (GRCm39) missense possibly damaging 0.52
R2122:Ltbp1 UTSW 17 75,617,154 (GRCm39) missense possibly damaging 0.52
R2171:Ltbp1 UTSW 17 75,598,312 (GRCm39) missense probably damaging 0.99
R2237:Ltbp1 UTSW 17 75,617,158 (GRCm39) missense probably benign 0.31
R2655:Ltbp1 UTSW 17 75,312,978 (GRCm39) missense possibly damaging 0.76
R2941:Ltbp1 UTSW 17 75,486,088 (GRCm39) missense probably damaging 1.00
R3177:Ltbp1 UTSW 17 75,666,273 (GRCm39) splice site probably null
R3177:Ltbp1 UTSW 17 75,583,475 (GRCm39) missense possibly damaging 0.65
R3277:Ltbp1 UTSW 17 75,666,273 (GRCm39) splice site probably null
R3277:Ltbp1 UTSW 17 75,583,475 (GRCm39) missense possibly damaging 0.65
R3797:Ltbp1 UTSW 17 75,669,625 (GRCm39) missense probably damaging 1.00
R3861:Ltbp1 UTSW 17 75,666,333 (GRCm39) missense possibly damaging 0.93
R3897:Ltbp1 UTSW 17 75,581,011 (GRCm39) missense probably damaging 1.00
R4002:Ltbp1 UTSW 17 75,617,154 (GRCm39) missense probably benign 0.09
R4057:Ltbp1 UTSW 17 75,617,189 (GRCm39) missense probably damaging 1.00
R4261:Ltbp1 UTSW 17 75,598,362 (GRCm39) nonsense probably null
R4375:Ltbp1 UTSW 17 75,619,992 (GRCm39) missense probably damaging 1.00
R4458:Ltbp1 UTSW 17 75,583,502 (GRCm39) missense possibly damaging 0.96
R4519:Ltbp1 UTSW 17 75,671,492 (GRCm39) missense probably benign 0.14
R4529:Ltbp1 UTSW 17 75,458,355 (GRCm39) missense probably benign 0.21
R4614:Ltbp1 UTSW 17 75,596,989 (GRCm39) intron probably benign
R4724:Ltbp1 UTSW 17 75,620,003 (GRCm39) missense probably damaging 0.99
R4756:Ltbp1 UTSW 17 75,532,199 (GRCm39) missense probably damaging 1.00
R4907:Ltbp1 UTSW 17 75,312,899 (GRCm39) missense probably benign
R4910:Ltbp1 UTSW 17 75,634,287 (GRCm39) missense probably damaging 1.00
R4976:Ltbp1 UTSW 17 75,628,090 (GRCm39) critical splice donor site probably null
R5011:Ltbp1 UTSW 17 75,373,152 (GRCm39) missense probably damaging 0.99
R5047:Ltbp1 UTSW 17 75,599,881 (GRCm39) splice site probably benign
R5259:Ltbp1 UTSW 17 75,670,357 (GRCm39) missense probably benign 0.03
R5438:Ltbp1 UTSW 17 75,598,321 (GRCm39) missense probably damaging 0.98
R5583:Ltbp1 UTSW 17 75,598,325 (GRCm39) missense probably benign 0.00
R5757:Ltbp1 UTSW 17 75,580,944 (GRCm39) splice site probably null
R5950:Ltbp1 UTSW 17 75,580,865 (GRCm39) missense probably damaging 1.00
R5976:Ltbp1 UTSW 17 75,597,078 (GRCm39) missense probably damaging 1.00
R6267:Ltbp1 UTSW 17 75,312,984 (GRCm39) missense possibly damaging 0.70
R6383:Ltbp1 UTSW 17 75,666,452 (GRCm39) missense probably damaging 0.99
R6400:Ltbp1 UTSW 17 75,458,397 (GRCm39) missense possibly damaging 0.62
R6861:Ltbp1 UTSW 17 75,534,187 (GRCm39) missense possibly damaging 0.76
R6880:Ltbp1 UTSW 17 75,628,044 (GRCm39) missense possibly damaging 0.77
R7168:Ltbp1 UTSW 17 75,598,361 (GRCm39) missense probably damaging 1.00
R7198:Ltbp1 UTSW 17 75,533,962 (GRCm39) missense possibly damaging 0.94
R7260:Ltbp1 UTSW 17 75,373,139 (GRCm39) missense probably benign 0.01
R7262:Ltbp1 UTSW 17 75,671,363 (GRCm39) missense probably damaging 1.00
R7340:Ltbp1 UTSW 17 75,634,223 (GRCm39) nonsense probably null
R7443:Ltbp1 UTSW 17 75,671,432 (GRCm39) missense probably damaging 1.00
R7510:Ltbp1 UTSW 17 75,659,712 (GRCm39) missense probably damaging 1.00
R7676:Ltbp1 UTSW 17 75,598,292 (GRCm39) missense possibly damaging 0.58
R7717:Ltbp1 UTSW 17 75,597,073 (GRCm39) missense possibly damaging 0.90
R7720:Ltbp1 UTSW 17 75,692,119 (GRCm39) missense probably damaging 1.00
R7799:Ltbp1 UTSW 17 75,559,351 (GRCm39) missense probably damaging 0.99
R7944:Ltbp1 UTSW 17 75,697,546 (GRCm39) makesense probably null
R7945:Ltbp1 UTSW 17 75,697,546 (GRCm39) makesense probably null
R7976:Ltbp1 UTSW 17 75,670,358 (GRCm39) missense possibly damaging 0.94
R8256:Ltbp1 UTSW 17 75,622,236 (GRCm39) intron probably benign
R8295:Ltbp1 UTSW 17 75,486,184 (GRCm39) missense probably benign 0.10
R8423:Ltbp1 UTSW 17 75,599,852 (GRCm39) missense probably benign
R8462:Ltbp1 UTSW 17 75,620,069 (GRCm39) missense probably damaging 1.00
R8677:Ltbp1 UTSW 17 75,655,753 (GRCm39) missense probably benign 0.00
R8742:Ltbp1 UTSW 17 75,617,217 (GRCm39) missense probably damaging 0.99
R8766:Ltbp1 UTSW 17 75,603,250 (GRCm39) nonsense probably null
R8873:Ltbp1 UTSW 17 75,486,172 (GRCm39) missense probably damaging 1.00
R8887:Ltbp1 UTSW 17 75,486,077 (GRCm39) missense probably damaging 1.00
R9100:Ltbp1 UTSW 17 75,622,103 (GRCm39) missense probably damaging 0.96
R9100:Ltbp1 UTSW 17 75,622,102 (GRCm39) missense probably benign 0.10
R9141:Ltbp1 UTSW 17 75,598,309 (GRCm39) missense possibly damaging 0.56
R9204:Ltbp1 UTSW 17 75,670,425 (GRCm39) missense probably damaging 1.00
R9292:Ltbp1 UTSW 17 75,583,436 (GRCm39) missense probably damaging 0.99
R9381:Ltbp1 UTSW 17 75,696,434 (GRCm39) missense probably damaging 1.00
R9423:Ltbp1 UTSW 17 75,597,112 (GRCm39) missense probably benign
R9426:Ltbp1 UTSW 17 75,598,309 (GRCm39) missense possibly damaging 0.56
R9448:Ltbp1 UTSW 17 75,666,455 (GRCm39) nonsense probably null
R9519:Ltbp1 UTSW 17 75,692,190 (GRCm39) missense probably damaging 1.00
R9523:Ltbp1 UTSW 17 75,697,498 (GRCm39) missense probably benign 0.29
R9625:Ltbp1 UTSW 17 75,486,157 (GRCm39) missense probably damaging 1.00
R9671:Ltbp1 UTSW 17 75,603,217 (GRCm39) critical splice acceptor site probably null
X0001:Ltbp1 UTSW 17 75,534,173 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCCAAAGTACTACTGTTTTATGGC -3'
(R):5'- TCCTGATGCTTGGCTATCGG -3'

Sequencing Primer
(F):5'- AGTACTACTGTTTTATGGCAATAAGC -3'
(R):5'- ATCGGCCACCAATACCTTATTTTTC -3'
Posted On 2014-07-14