Mutagenetix > Incidental Mutations

Incidental Mutation 'R1933:Tlr1'

215550

Institutional Source

Beutler Lab

Gene Symbol

Tlr1

Ensembl Gene

ENSMUSG00000044827

Gene Name

toll-like receptor 1

Synonyms

MMRRC Submission

039951-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1933 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64924679-64933563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 64925438 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 599 (T599P)

Ref Sequence

ENSEMBL: ENSMUSP00000142500 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059349] [ENSMUST00000197315]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000059349
AA Change: T599P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000060793
Gene: ENSMUSG00000044827
AA Change: T599P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LRR	71	94	5.72e0	SMART
LRR	116	140	3.27e2	SMART
low complexity region	240	256	N/A	INTRINSIC
LRR	374	397	9.75e0	SMART
LRR	400	423	4.98e1	SMART
low complexity region	427	438	N/A	INTRINSIC
LRR	448	469	6.23e1	SMART
LRR	470	494	4.57e0	SMART
LRRCT	527	581	2.5e-11	SMART
transmembrane domain	583	605	N/A	INTRINSIC
TIR	639	782	4.03e-41	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000197315
AA Change: T599P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142500
Gene: ENSMUSG00000044827
AA Change: T599P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
LRR	71	94	5.72e0	SMART
Pfam:LRR_1	97	114	2.3e-2	PFAM
LRR	116	140	3.27e2	SMART
low complexity region	240	256	N/A	INTRINSIC
LRR	374	397	9.75e0	SMART
LRR	400	423	4.98e1	SMART
low complexity region	427	438	N/A	INTRINSIC
LRR	448	469	6.23e1	SMART
LRR	470	494	4.57e0	SMART
LRRCT	527	581	2.5e-11	SMART
transmembrane domain	583	605	N/A	INTRINSIC
TIR	639	782	4.03e-41	SMART

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased macrophage peptoglycan-stimulated IL-6 production. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	A	T	8: 40,754,885	Y396F	probably benign	Het
Adra2a	T	A	19: 54,046,406	F64L	probably damaging	Het
Ankrd45	A	T	1: 161,151,300	N103I	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Bsn	A	G	9: 108,116,444	V703A	possibly damaging	Het
Btaf1	T	A	19: 36,972,957	I529K	probably damaging	Het
Ccdc110	A	G	8: 45,943,250	N726S	probably damaging	Het
Ccdc78	T	A	17: 25,787,070	S71T	probably damaging	Het
Cct5	G	T	15: 31,591,008	Q516K	probably benign	Het
Cd300c2	A	T	11: 115,000,859	V63E	probably benign	Het
Cdh16	A	G	8: 104,617,963	V7A	possibly damaging	Het
Clec16a	T	C	16: 10,688,539	F710L	probably damaging	Het
Clpb	T	G	7: 101,779,211	F393V	probably damaging	Het
Commd9	G	A	2: 101,901,031	R187H	probably damaging	Het
Crx	T	A	7: 15,868,376	K126*	probably null	Het
Dcaf13	T	A	15: 39,138,088	Y264N	probably damaging	Het
Dnah12	T	A	14: 26,734,495	I791N	probably damaging	Het
Dpy19l1	A	T	9: 24,434,387	D456E	probably damaging	Het
Dscam	A	G	16: 96,593,214	S1963P	probably benign	Het
Efl1	C	T	7: 82,763,117	Q905*	probably null	Het
Fam57b	T	A	7: 126,827,672		probably null	Het
Farsa	T	C	8: 84,861,151	F104L	probably benign	Het
Fbxl19	C	A	7: 127,750,929	A231E	probably benign	Het
Fbxw19	A	T	9: 109,481,650	N401K	probably benign	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,075,965		probably benign	Het
Frem3	A	G	8: 80,612,890	N604S	probably benign	Het
Gad1	T	G	2: 70,587,392	C312G	possibly damaging	Het
Garem2	G	T	5: 30,114,862	E441*	probably null	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm8206	A	T	14: 6,022,475	M8K	probably benign	Het
Gpr162	G	A	6: 124,861,447	S80F	probably damaging	Het
Grpr	C	A	X: 163,549,141	V53L	probably benign	Het
Il21	C	T	3: 37,232,486	R27H	probably benign	Het
Il21r	C	T	7: 125,628,981	T208I	possibly damaging	Het
Kcnab2	T	C	4: 152,435,866	T6A	possibly damaging	Het
Klra4	T	A	6: 130,065,244	Q20L	possibly damaging	Het
Lrrtm1	A	T	6: 77,244,966		probably null	Het
Lrrtm3	A	G	10: 64,088,513	F292L	possibly damaging	Het
Mpeg1	A	T	19: 12,462,647	K490*	probably null	Het
Myh14	C	T	7: 44,615,348	M1671I	probably benign	Het
Nebl	A	T	2: 17,375,292	M757K	probably damaging	Het
Olfr1110	T	A	2: 87,135,844	H159L	probably damaging	Het
Olfr504	A	C	7: 108,565,523	F91V	possibly damaging	Het
Olfr631	G	T	7: 103,929,130	M102I	probably damaging	Het
Pkhd1l1	A	T	15: 44,540,884	H2303L	possibly damaging	Het
Podxl2	C	T	6: 88,849,605	V240M	probably benign	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prss53	T	C	7: 127,886,262	*553W	probably null	Het
Psma3	T	A	12: 70,984,694	M43K	probably benign	Het
Rad50	G	T	11: 53,680,061	T790K	probably benign	Het
Rasgrf1	G	T	9: 89,953,913	Q231H	probably damaging	Het
Rpn1	T	A	6: 88,093,859	V237E	probably damaging	Het
Scn10a	T	A	9: 119,609,998	M1601L	probably damaging	Het
Sema4f	G	T	6: 82,930,927	P180Q	probably damaging	Het
Serpinb5	A	G	1: 106,876,121	E8G	probably damaging	Het
Sgcg	C	T	14: 61,232,412	V167I	possibly damaging	Het
Slc25a13	C	T	6: 6,109,262	V367M	probably damaging	Het
Spata31	T	C	13: 64,920,610	S191P	probably benign	Het
Srbd1	A	G	17: 86,102,893	V537A	probably damaging	Het
Srgap1	G	T	10: 121,925,903	D113E	possibly damaging	Het
Srl	A	G	16: 4,492,350	I505T	probably damaging	Het
St14	G	A	9: 31,106,212	T226I	probably benign	Het
Stard9	T	A	2: 120,698,656	I1798N	possibly damaging	Het
Sugp1	A	G	8: 70,056,575	E166G	possibly damaging	Het
Susd1	A	T	4: 59,351,695	N455K	possibly damaging	Het
Sytl3	T	A	17: 6,733,046	V205E	probably damaging	Het
Tenm4	A	G	7: 96,895,326	Y2183C	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Trpc6	G	A	9: 8,656,545	D658N	probably damaging	Het
Ttc39b	A	G	4: 83,232,720	V546A	possibly damaging	Het
Ube3c	T	C	5: 29,619,659	Y561H	probably damaging	Het
Vmn1r29	T	A	6: 58,307,420	S42T	probably benign	Het
Vps4a	T	C	8: 107,044,558	V392A	probably benign	Het
Wdfy4	T	C	14: 33,133,344	E771G	probably benign	Het
Whrn	G	A	4: 63,415,639	Q415*	probably null	Het
Wnt5a	C	T	14: 28,511,845	P10L	probably benign	Het
Zfhx2	T	C	14: 55,075,238		probably benign	Het
Zfp451	T	C	1: 33,777,822	K132R	probably damaging	Het

Other mutations in Tlr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Tlr1	APN	5	64926434	missense	probably benign	0.01
IGL01324:Tlr1	APN	5	64925179	missense	probably damaging	1.00
IGL01564:Tlr1	APN	5	64925846	missense	probably damaging	1.00
IGL01663:Tlr1	APN	5	64925073	missense	possibly damaging	0.48
IGL01689:Tlr1	APN	5	64925779	missense	probably damaging	0.97
IGL01749:Tlr1	APN	5	64925947	nonsense	probably null
IGL01751:Tlr1	APN	5	64925947	nonsense	probably null
IGL01769:Tlr1	APN	5	64925947	nonsense	probably null
IGL01899:Tlr1	APN	5	64927016	missense	probably damaging	0.97
IGL02197:Tlr1	APN	5	64926454	missense	probably damaging	1.00
IGL02295:Tlr1	APN	5	64925947	nonsense	probably null
IGL02308:Tlr1	APN	5	64925947	nonsense	probably null
IGL02309:Tlr1	APN	5	64925947	nonsense	probably null
IGL02311:Tlr1	APN	5	64925947	nonsense	probably null
IGL02591:Tlr1	APN	5	64926716	missense	probably damaging	1.00
IGL02739:Tlr1	APN	5	64927126	missense	probably benign	0.41
IGL03206:Tlr1	APN	5	64925057	missense	probably damaging	0.99
IGL03055:Tlr1	UTSW	5	64926596	missense	probably benign	0.05
R0315:Tlr1	UTSW	5	64926928	missense	probably damaging	0.99
R0317:Tlr1	UTSW	5	64925967	nonsense	probably null
R0511:Tlr1	UTSW	5	64926620	missense	probably damaging	0.98
R1539:Tlr1	UTSW	5	64926976	missense	probably damaging	1.00
R1552:Tlr1	UTSW	5	64926860	missense	probably damaging	1.00
R1835:Tlr1	UTSW	5	64925700	missense	probably benign	0.01
R1956:Tlr1	UTSW	5	64925177	missense	probably damaging	1.00
R2099:Tlr1	UTSW	5	64925068	missense	probably damaging	1.00
R2507:Tlr1	UTSW	5	64925296	missense	probably damaging	1.00
R2508:Tlr1	UTSW	5	64925296	missense	probably damaging	1.00
R2937:Tlr1	UTSW	5	64925908	missense	probably damaging	0.96
R2938:Tlr1	UTSW	5	64925908	missense	probably damaging	0.96
R3033:Tlr1	UTSW	5	64925569	missense	probably damaging	1.00
R4164:Tlr1	UTSW	5	64927202	missense	possibly damaging	0.47
R4226:Tlr1	UTSW	5	64925717	missense	probably damaging	0.96
R4366:Tlr1	UTSW	5	64925837	missense	probably benign	0.00
R5009:Tlr1	UTSW	5	64926224	missense	probably damaging	1.00
R5029:Tlr1	UTSW	5	64925681	missense	probably damaging	0.97
R5069:Tlr1	UTSW	5	64926400	missense	probably benign	0.01
R5186:Tlr1	UTSW	5	64925221	missense	probably damaging	1.00
R5336:Tlr1	UTSW	5	64925802	missense	probably damaging	1.00
R5500:Tlr1	UTSW	5	64927098	missense	probably benign	0.08
R5503:Tlr1	UTSW	5	64926292	missense	probably damaging	0.99
R5577:Tlr1	UTSW	5	64926085	missense	possibly damaging	0.94
R6141:Tlr1	UTSW	5	64925213	missense	possibly damaging	0.92
R6210:Tlr1	UTSW	5	64925286	missense	probably damaging	1.00
R6238:Tlr1	UTSW	5	64927129	missense	possibly damaging	0.86
R6284:Tlr1	UTSW	5	64927099	missense	possibly damaging	0.93
R6311:Tlr1	UTSW	5	64926845	missense	probably damaging	0.99
R7021:Tlr1	UTSW	5	64925713	missense	possibly damaging	0.75
R7140:Tlr1	UTSW	5	64925678	missense	probably benign	0.01
R7234:Tlr1	UTSW	5	64926724	missense	probably damaging	0.96
R7278:Tlr1	UTSW	5	64926772	missense	probably benign	0.03
R7378:Tlr1	UTSW	5	64925228	missense	not run
R7652:Tlr1	UTSW	5	64926787	nonsense	probably null
R7781:Tlr1	UTSW	5	64926736	missense	possibly damaging	0.94
R7783:Tlr1	UTSW	5	64924921	missense	probably damaging	1.00
R7851:Tlr1	UTSW	5	64924964	missense	possibly damaging	0.58
R8546:Tlr1	UTSW	5	64927031	missense	probably damaging	0.99
X0067:Tlr1	UTSW	5	64926575	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGGCAAATCTGGATGTCATC -3'
(R):5'- TGAGCTGAGGGACTTTGTCAAG -3'

Sequencing Primer
(F):5'- GGTAGTAATTCGTTCTTCACCCAGG -3'
(R):5'- CTTTGTCAAGAACATAGGCTGG -3'

Posted On

2014-07-14