Incidental Mutation 'R1933:Rpn1'
ID215556
Institutional Source Beutler Lab
Gene Symbol Rpn1
Ensembl Gene ENSMUSG00000030062
Gene Nameribophorin I
SynonymsD6Wsu137e, Rpn-1
MMRRC Submission 039951-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1933 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location88084482-88105304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88093859 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 237 (V237E)
Ref Sequence ENSEMBL: ENSMUSP00000032143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032143]
Predicted Effect probably damaging
Transcript: ENSMUST00000032143
AA Change: V237E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032143
Gene: ENSMUSG00000030062
AA Change: V237E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Ribophorin_I 32 458 4.2e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203813
Predicted Effect probably benign
Transcript: ENSMUST00000204838
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I integral membrane protein found only in the rough endoplasmic reticulum. The encoded protein is part of an N-oligosaccharyl transferase complex that links high mannose oligosaccharides to asparagine residues found in the Asn-X-Ser/Thr consensus motif of nascent polypeptide chains. This protein forms part of the regulatory subunit of the 26S proteasome and may mediate binding of ubiquitin-like domains to this proteasome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adra2a T A 19: 54,046,406 F64L probably damaging Het
Ankrd45 A T 1: 161,151,300 N103I probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bsn A G 9: 108,116,444 V703A possibly damaging Het
Btaf1 T A 19: 36,972,957 I529K probably damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Ccdc78 T A 17: 25,787,070 S71T probably damaging Het
Cct5 G T 15: 31,591,008 Q516K probably benign Het
Cd300c2 A T 11: 115,000,859 V63E probably benign Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Clec16a T C 16: 10,688,539 F710L probably damaging Het
Clpb T G 7: 101,779,211 F393V probably damaging Het
Commd9 G A 2: 101,901,031 R187H probably damaging Het
Crx T A 7: 15,868,376 K126* probably null Het
Dcaf13 T A 15: 39,138,088 Y264N probably damaging Het
Dnah12 T A 14: 26,734,495 I791N probably damaging Het
Dpy19l1 A T 9: 24,434,387 D456E probably damaging Het
Dscam A G 16: 96,593,214 S1963P probably benign Het
Efl1 C T 7: 82,763,117 Q905* probably null Het
Fam57b T A 7: 126,827,672 probably null Het
Farsa T C 8: 84,861,151 F104L probably benign Het
Fbxl19 C A 7: 127,750,929 A231E probably benign Het
Fbxw19 A T 9: 109,481,650 N401K probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Frem3 A G 8: 80,612,890 N604S probably benign Het
Gad1 T G 2: 70,587,392 C312G possibly damaging Het
Garem2 G T 5: 30,114,862 E441* probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm8206 A T 14: 6,022,475 M8K probably benign Het
Gpr162 G A 6: 124,861,447 S80F probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Il21 C T 3: 37,232,486 R27H probably benign Het
Il21r C T 7: 125,628,981 T208I possibly damaging Het
Kcnab2 T C 4: 152,435,866 T6A possibly damaging Het
Klra4 T A 6: 130,065,244 Q20L possibly damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Lrrtm3 A G 10: 64,088,513 F292L possibly damaging Het
Mpeg1 A T 19: 12,462,647 K490* probably null Het
Myh14 C T 7: 44,615,348 M1671I probably benign Het
Nebl A T 2: 17,375,292 M757K probably damaging Het
Olfr1110 T A 2: 87,135,844 H159L probably damaging Het
Olfr504 A C 7: 108,565,523 F91V possibly damaging Het
Olfr631 G T 7: 103,929,130 M102I probably damaging Het
Pkhd1l1 A T 15: 44,540,884 H2303L possibly damaging Het
Podxl2 C T 6: 88,849,605 V240M probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prss53 T C 7: 127,886,262 *553W probably null Het
Psma3 T A 12: 70,984,694 M43K probably benign Het
Rad50 G T 11: 53,680,061 T790K probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Scn10a T A 9: 119,609,998 M1601L probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Serpinb5 A G 1: 106,876,121 E8G probably damaging Het
Sgcg C T 14: 61,232,412 V167I possibly damaging Het
Slc25a13 C T 6: 6,109,262 V367M probably damaging Het
Spata31 T C 13: 64,920,610 S191P probably benign Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Srgap1 G T 10: 121,925,903 D113E possibly damaging Het
Srl A G 16: 4,492,350 I505T probably damaging Het
St14 G A 9: 31,106,212 T226I probably benign Het
Stard9 T A 2: 120,698,656 I1798N possibly damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Susd1 A T 4: 59,351,695 N455K possibly damaging Het
Sytl3 T A 17: 6,733,046 V205E probably damaging Het
Tenm4 A G 7: 96,895,326 Y2183C probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tlr1 T G 5: 64,925,438 T599P possibly damaging Het
Trpc6 G A 9: 8,656,545 D658N probably damaging Het
Ttc39b A G 4: 83,232,720 V546A possibly damaging Het
Ube3c T C 5: 29,619,659 Y561H probably damaging Het
Vmn1r29 T A 6: 58,307,420 S42T probably benign Het
Vps4a T C 8: 107,044,558 V392A probably benign Het
Wdfy4 T C 14: 33,133,344 E771G probably benign Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Wnt5a C T 14: 28,511,845 P10L probably benign Het
Zfhx2 T C 14: 55,075,238 probably benign Het
Zfp451 T C 1: 33,777,822 K132R probably damaging Het
Other mutations in Rpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Rpn1 APN 6 88095629 missense probably damaging 0.97
IGL02614:Rpn1 APN 6 88102105 missense probably benign 0.03
R0101:Rpn1 UTSW 6 88093787 missense possibly damaging 0.96
R0101:Rpn1 UTSW 6 88093787 missense possibly damaging 0.96
R0505:Rpn1 UTSW 6 88090242 missense probably benign 0.01
R1655:Rpn1 UTSW 6 88100944 missense possibly damaging 0.78
R1934:Rpn1 UTSW 6 88093859 missense probably damaging 1.00
R1968:Rpn1 UTSW 6 88095548 missense possibly damaging 0.87
R2020:Rpn1 UTSW 6 88095683 missense probably damaging 1.00
R2074:Rpn1 UTSW 6 88100962 missense probably damaging 1.00
R3237:Rpn1 UTSW 6 88103414 missense probably benign 0.00
R3722:Rpn1 UTSW 6 88090300 splice site probably null
R4837:Rpn1 UTSW 6 88090205 missense probably benign 0.10
R5546:Rpn1 UTSW 6 88093859 missense probably damaging 1.00
R6989:Rpn1 UTSW 6 88099303 missense probably benign 0.02
R7292:Rpn1 UTSW 6 88090084 missense probably damaging 1.00
R7296:Rpn1 UTSW 6 88084637 missense possibly damaging 0.46
R7623:Rpn1 UTSW 6 88084568 missense possibly damaging 0.96
R7816:Rpn1 UTSW 6 88103396 missense possibly damaging 0.87
R7960:Rpn1 UTSW 6 88102086 missense probably damaging 1.00
R8553:Rpn1 UTSW 6 88095557 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGATGCTTGGTGACCATTG -3'
(R):5'- GACCCTTCTAGCAGTGATATTCAAC -3'

Sequencing Primer
(F):5'- ATGCTTGGTGACCATTGTGTGATG -3'
(R):5'- GGACACACGGATAGTCACAGTTC -3'
Genotyping

NOTE: These primers have not been validated.

 

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

R19330031_PCR_F: 5’- CTGATGCTTGGTGACCATTG-3’

R19330031_PCR_R: 5’- GACCCTTCTAGCAGTGATATTCAAC-3’

 

Sequencing Primers

R19330031_SEQ_F: 5’- ATGCTTGGTGACCATTGTGTGATG-3’
 

R19330031_SEQ_R: 5’- GGACACACGGATAGTCACAGTTC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 439 nucleotides is amplified (NCBI RefSeq: NC_000072, chromosome 6):

 

ctgatgcttg gtgaccattg tgtgatggtt cacaggctct cgctagtttc ttttaagcta       

gtgtgggctt ctctgttgct aaagctatgg actgcttgtt tccttcccat ctaggacact      

ttcaaagtac attacgagaa caatagccct ttcctgacca tcaccagtat gacccgggtc      

atcgaggtat ctcactgggg caatattgct gtggaagaga acgtggactt gaagcacacg      

ggcgcagtgc tgaaggggcc tttctcccgc tacgattacc agaggcagcc tgacagtggg      

atctcctcca ttcgttcttt taaggtatga gtggccacct tgttcactgt gggaactgtg      

actatccgtg tgtcctttct ttcacttttt agtttggggg gattaactaa cgatgttgaa      

tatcactgct agaagggtc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. + strand, T>A).

Posted On2014-07-14