Mutagenetix > Incidental Mutations

Incidental Mutation 'R1933:Il21r'

215569

Institutional Source

Beutler Lab

Gene Symbol

Il21r

Ensembl Gene

ENSMUSG00000030745

Gene Name

interleukin 21 receptor

Synonyms

NILR

MMRRC Submission

039951-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.078) question?

Stock #

R1933 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125603429-125633570 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 125628981 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 208 (T208I)

Ref Sequence

ENSEMBL: ENSMUSP00000145966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033000] [ENSMUST00000206103] [ENSMUST00000206234]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033000
AA Change: T208I

PolyPhen 2 Score 0.794 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000033000
Gene: ENSMUSG00000030745
AA Change: T208I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
FN3	120	209	3.4e0	SMART
low complexity region	239	250	N/A	INTRINSIC
low complexity region	307	312	N/A	INTRINSIC
low complexity region	424	450	N/A	INTRINSIC
low complexity region	466	481	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206103
AA Change: T208I

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000206234

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mutation of this gene results in decreased immunoglobulin levels, decreased Th17 T cell differentation, and decreased production of IL-17. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	A	T	8: 40,754,885	Y396F	probably benign	Het
Adra2a	T	A	19: 54,046,406	F64L	probably damaging	Het
Ankrd45	A	T	1: 161,151,300	N103I	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Bsn	A	G	9: 108,116,444	V703A	possibly damaging	Het
Btaf1	T	A	19: 36,972,957	I529K	probably damaging	Het
Ccdc110	A	G	8: 45,943,250	N726S	probably damaging	Het
Ccdc78	T	A	17: 25,787,070	S71T	probably damaging	Het
Cct5	G	T	15: 31,591,008	Q516K	probably benign	Het
Cd300c2	A	T	11: 115,000,859	V63E	probably benign	Het
Cdh16	A	G	8: 104,617,963	V7A	possibly damaging	Het
Clec16a	T	C	16: 10,688,539	F710L	probably damaging	Het
Clpb	T	G	7: 101,779,211	F393V	probably damaging	Het
Commd9	G	A	2: 101,901,031	R187H	probably damaging	Het
Crx	T	A	7: 15,868,376	K126*	probably null	Het
Dcaf13	T	A	15: 39,138,088	Y264N	probably damaging	Het
Dnah12	T	A	14: 26,734,495	I791N	probably damaging	Het
Dpy19l1	A	T	9: 24,434,387	D456E	probably damaging	Het
Dscam	A	G	16: 96,593,214	S1963P	probably benign	Het
Efl1	C	T	7: 82,763,117	Q905*	probably null	Het
Fam57b	T	A	7: 126,827,672		probably null	Het
Farsa	T	C	8: 84,861,151	F104L	probably benign	Het
Fbxl19	C	A	7: 127,750,929	A231E	probably benign	Het
Fbxw19	A	T	9: 109,481,650	N401K	probably benign	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,075,965		probably benign	Het
Frem3	A	G	8: 80,612,890	N604S	probably benign	Het
Gad1	T	G	2: 70,587,392	C312G	possibly damaging	Het
Garem2	G	T	5: 30,114,862	E441*	probably null	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm8206	A	T	14: 6,022,475	M8K	probably benign	Het
Gpr162	G	A	6: 124,861,447	S80F	probably damaging	Het
Grpr	C	A	X: 163,549,141	V53L	probably benign	Het
Il21	C	T	3: 37,232,486	R27H	probably benign	Het
Kcnab2	T	C	4: 152,435,866	T6A	possibly damaging	Het
Klra4	T	A	6: 130,065,244	Q20L	possibly damaging	Het
Lrrtm1	A	T	6: 77,244,966		probably null	Het
Lrrtm3	A	G	10: 64,088,513	F292L	possibly damaging	Het
Mpeg1	A	T	19: 12,462,647	K490*	probably null	Het
Myh14	C	T	7: 44,615,348	M1671I	probably benign	Het
Nebl	A	T	2: 17,375,292	M757K	probably damaging	Het
Olfr1110	T	A	2: 87,135,844	H159L	probably damaging	Het
Olfr504	A	C	7: 108,565,523	F91V	possibly damaging	Het
Olfr631	G	T	7: 103,929,130	M102I	probably damaging	Het
Pkhd1l1	A	T	15: 44,540,884	H2303L	possibly damaging	Het
Podxl2	C	T	6: 88,849,605	V240M	probably benign	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prss53	T	C	7: 127,886,262	*553W	probably null	Het
Psma3	T	A	12: 70,984,694	M43K	probably benign	Het
Rad50	G	T	11: 53,680,061	T790K	probably benign	Het
Rasgrf1	G	T	9: 89,953,913	Q231H	probably damaging	Het
Rpn1	T	A	6: 88,093,859	V237E	probably damaging	Het
Scn10a	T	A	9: 119,609,998	M1601L	probably damaging	Het
Sema4f	G	T	6: 82,930,927	P180Q	probably damaging	Het
Serpinb5	A	G	1: 106,876,121	E8G	probably damaging	Het
Sgcg	C	T	14: 61,232,412	V167I	possibly damaging	Het
Slc25a13	C	T	6: 6,109,262	V367M	probably damaging	Het
Spata31	T	C	13: 64,920,610	S191P	probably benign	Het
Srbd1	A	G	17: 86,102,893	V537A	probably damaging	Het
Srgap1	G	T	10: 121,925,903	D113E	possibly damaging	Het
Srl	A	G	16: 4,492,350	I505T	probably damaging	Het
St14	G	A	9: 31,106,212	T226I	probably benign	Het
Stard9	T	A	2: 120,698,656	I1798N	possibly damaging	Het
Sugp1	A	G	8: 70,056,575	E166G	possibly damaging	Het
Susd1	A	T	4: 59,351,695	N455K	possibly damaging	Het
Sytl3	T	A	17: 6,733,046	V205E	probably damaging	Het
Tenm4	A	G	7: 96,895,326	Y2183C	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tlr1	T	G	5: 64,925,438	T599P	possibly damaging	Het
Trpc6	G	A	9: 8,656,545	D658N	probably damaging	Het
Ttc39b	A	G	4: 83,232,720	V546A	possibly damaging	Het
Ube3c	T	C	5: 29,619,659	Y561H	probably damaging	Het
Vmn1r29	T	A	6: 58,307,420	S42T	probably benign	Het
Vps4a	T	C	8: 107,044,558	V392A	probably benign	Het
Wdfy4	T	C	14: 33,133,344	E771G	probably benign	Het
Whrn	G	A	4: 63,415,639	Q415*	probably null	Het
Wnt5a	C	T	14: 28,511,845	P10L	probably benign	Het
Zfhx2	T	C	14: 55,075,238		probably benign	Het
Zfp451	T	C	1: 33,777,822	K132R	probably damaging	Het

Other mutations in Il21r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Il21r	APN	7	125632525	missense	probably damaging	1.00
bellflower	UTSW	7	125628043	critical splice acceptor site	probably null
R0409:Il21r	UTSW	7	125629840	intron	probably benign
R0573:Il21r	UTSW	7	125625285	missense	probably benign	0.06
R0635:Il21r	UTSW	7	125632506	missense	probably damaging	1.00
R1969:Il21r	UTSW	7	125628972	missense	probably damaging	0.99
R3716:Il21r	UTSW	7	125632269	missense	probably damaging	0.96
R3968:Il21r	UTSW	7	125628043	critical splice acceptor site	probably null
R4546:Il21r	UTSW	7	125628899	missense	probably damaging	1.00
R5086:Il21r	UTSW	7	125632855	missense	probably damaging	0.99
R5566:Il21r	UTSW	7	125625298	missense	probably damaging	1.00
R5988:Il21r	UTSW	7	125632288	missense	probably damaging	0.99
R6234:Il21r	UTSW	7	125632585	missense	probably damaging	1.00
R6259:Il21r	UTSW	7	125630719	missense	possibly damaging	0.65
R6896:Il21r	UTSW	7	125626956	missense	probably damaging	1.00
R7162:Il21r	UTSW	7	125632311	missense	probably benign	0.00
R7263:Il21r	UTSW	7	125632905	missense	probably benign	0.04
R7740:Il21r	UTSW	7	125632555	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGCTCTAGTCAGGGATGTGC -3'
(R):5'- ATGTATAACTGAGCACAGACCTCC -3'

Sequencing Primer
(F):5'- AAGGACTCTGTGCTCTACTGATGAC -3'
(R):5'- AGACCTCCCAGCCATGC -3'

Posted On

2014-07-14