Incidental Mutation 'R1933:Vps4a'
ID215585
Institutional Source Beutler Lab
Gene Symbol Vps4a
Ensembl Gene ENSMUSG00000031913
Gene Namevacuolar protein sorting 4A
Synonyms4930589C15Rik
MMRRC Submission 039951-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1933 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107031222-107045755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107044558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 392 (V392A)
Ref Sequence ENSEMBL: ENSMUSP00000034388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034388] [ENSMUST00000034391] [ENSMUST00000055316] [ENSMUST00000095517]
Predicted Effect probably benign
Transcript: ENSMUST00000034388
AA Change: V392A

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034388
Gene: ENSMUSG00000031913
AA Change: V392A

DomainStartEndE-ValueType
MIT 2 80 2.02e-27 SMART
low complexity region 90 102 N/A INTRINSIC
AAA 159 295 2.89e-22 SMART
Blast:AAA 329 358 8e-9 BLAST
Pfam:Vps4_C 374 434 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034391
SMART Domains Protein: ENSMUSP00000034391
Gene: ENSMUSG00000031916

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000055316
SMART Domains Protein: ENSMUSP00000138676
Gene: ENSMUSG00000078931

DomainStartEndE-ValueType
Pfam:Pep_deformylase 52 222 2.3e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095517
SMART Domains Protein: ENSMUSP00000093173
Gene: ENSMUSG00000031916

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:Dor1 56 394 7.6e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144527
Predicted Effect probably benign
Transcript: ENSMUST00000154271
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the AAA protein family (ATPases associated with diverse cellular activities), and is the homolog of the yeast Vps4 protein. In humans, two paralogs of the yeast protein have been identified. The former share a high degree of aa sequence similarity with each other, and also with yeast Vps4 and mouse Skd1 proteins. The mouse Skd1 (suppressor of K+ transport defect 1) has been shown to be really an yeast Vps4 ortholog. Functional studies indicate that both human paralogs associate with the endosomal compartments, and are involved in intracellular protein trafficking, similar to Vps4 protein in yeast. The gene encoding this paralog has been mapped to chromosome 16; the gene for the other resides on chromosome 18. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adra2a T A 19: 54,046,406 F64L probably damaging Het
Ankrd45 A T 1: 161,151,300 N103I probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bsn A G 9: 108,116,444 V703A possibly damaging Het
Btaf1 T A 19: 36,972,957 I529K probably damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Ccdc78 T A 17: 25,787,070 S71T probably damaging Het
Cct5 G T 15: 31,591,008 Q516K probably benign Het
Cd300c2 A T 11: 115,000,859 V63E probably benign Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Clec16a T C 16: 10,688,539 F710L probably damaging Het
Clpb T G 7: 101,779,211 F393V probably damaging Het
Commd9 G A 2: 101,901,031 R187H probably damaging Het
Crx T A 7: 15,868,376 K126* probably null Het
Dcaf13 T A 15: 39,138,088 Y264N probably damaging Het
Dnah12 T A 14: 26,734,495 I791N probably damaging Het
Dpy19l1 A T 9: 24,434,387 D456E probably damaging Het
Dscam A G 16: 96,593,214 S1963P probably benign Het
Efl1 C T 7: 82,763,117 Q905* probably null Het
Fam57b T A 7: 126,827,672 probably null Het
Farsa T C 8: 84,861,151 F104L probably benign Het
Fbxl19 C A 7: 127,750,929 A231E probably benign Het
Fbxw19 A T 9: 109,481,650 N401K probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Frem3 A G 8: 80,612,890 N604S probably benign Het
Gad1 T G 2: 70,587,392 C312G possibly damaging Het
Garem2 G T 5: 30,114,862 E441* probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm8206 A T 14: 6,022,475 M8K probably benign Het
Gpr162 G A 6: 124,861,447 S80F probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Il21 C T 3: 37,232,486 R27H probably benign Het
Il21r C T 7: 125,628,981 T208I possibly damaging Het
Kcnab2 T C 4: 152,435,866 T6A possibly damaging Het
Klra4 T A 6: 130,065,244 Q20L possibly damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Lrrtm3 A G 10: 64,088,513 F292L possibly damaging Het
Mpeg1 A T 19: 12,462,647 K490* probably null Het
Myh14 C T 7: 44,615,348 M1671I probably benign Het
Nebl A T 2: 17,375,292 M757K probably damaging Het
Olfr1110 T A 2: 87,135,844 H159L probably damaging Het
Olfr504 A C 7: 108,565,523 F91V possibly damaging Het
Olfr631 G T 7: 103,929,130 M102I probably damaging Het
Pkhd1l1 A T 15: 44,540,884 H2303L possibly damaging Het
Podxl2 C T 6: 88,849,605 V240M probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prss53 T C 7: 127,886,262 *553W probably null Het
Psma3 T A 12: 70,984,694 M43K probably benign Het
Rad50 G T 11: 53,680,061 T790K probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Scn10a T A 9: 119,609,998 M1601L probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Serpinb5 A G 1: 106,876,121 E8G probably damaging Het
Sgcg C T 14: 61,232,412 V167I possibly damaging Het
Slc25a13 C T 6: 6,109,262 V367M probably damaging Het
Spata31 T C 13: 64,920,610 S191P probably benign Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Srgap1 G T 10: 121,925,903 D113E possibly damaging Het
Srl A G 16: 4,492,350 I505T probably damaging Het
St14 G A 9: 31,106,212 T226I probably benign Het
Stard9 T A 2: 120,698,656 I1798N possibly damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Susd1 A T 4: 59,351,695 N455K possibly damaging Het
Sytl3 T A 17: 6,733,046 V205E probably damaging Het
Tenm4 A G 7: 96,895,326 Y2183C probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tlr1 T G 5: 64,925,438 T599P possibly damaging Het
Trpc6 G A 9: 8,656,545 D658N probably damaging Het
Ttc39b A G 4: 83,232,720 V546A possibly damaging Het
Ube3c T C 5: 29,619,659 Y561H probably damaging Het
Vmn1r29 T A 6: 58,307,420 S42T probably benign Het
Wdfy4 T C 14: 33,133,344 E771G probably benign Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Wnt5a C T 14: 28,511,845 P10L probably benign Het
Zfhx2 T C 14: 55,075,238 probably benign Het
Zfp451 T C 1: 33,777,822 K132R probably damaging Het
Other mutations in Vps4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Vps4a APN 8 107042626 missense probably benign 0.00
IGL01123:Vps4a APN 8 107039219 splice site probably benign
IGL01538:Vps4a APN 8 107036924 missense probably benign 0.03
IGL02524:Vps4a APN 8 107036751 splice site probably benign
IGL02601:Vps4a APN 8 107043061 missense probably damaging 1.00
IGL02616:Vps4a APN 8 107042277 missense probably damaging 1.00
IGL03216:Vps4a APN 8 107036703 missense probably damaging 0.99
R0047:Vps4a UTSW 8 107036701 missense probably damaging 0.97
R0047:Vps4a UTSW 8 107036701 missense probably damaging 0.97
R0330:Vps4a UTSW 8 107043066 missense probably benign 0.01
R1384:Vps4a UTSW 8 107036644 missense possibly damaging 0.94
R7729:Vps4a UTSW 8 107040897 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAACCTCAGTACTCCCTTCAGC -3'
(R):5'- CAGGCCTTGGAATGATAGTGTC -3'

Sequencing Primer
(F):5'- GCCAGCCTTAGGTCCTGATGTAC -3'
(R):5'- GGCTTTTCTTCTTAAAGACCCTTAGG -3'
Posted On2014-07-14