Mutagenetix > Incidental Mutations

Incidental Mutation 'R1933:St14'

215589

Institutional Source

Beutler Lab

Gene Symbol

St14

Ensembl Gene

ENSMUSG00000031995

Gene Name

suppression of tumorigenicity 14 (colon carcinoma)

Synonyms

MT-SP1, matriptase, Tmprss14, Prss14, Epithin

MMRRC Submission

039951-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1933 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

31089402-31131853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31106212 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 226 (T226I)

Ref Sequence

ENSEMBL: ENSMUSP00000034478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034478] [ENSMUST00000123557] [ENSMUST00000214418]

Predicted Effect

probably benign
Transcript: ENSMUST00000034478
AA Change: T226I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995
AA Change: T226I

Domain	Start	End	E-Value	Type
transmembrane domain	55	77	N/A	INTRINSIC
Pfam:SEA	88	181	7.9e-17	PFAM
CUB	214	334	4.24e-14	SMART
CUB	340	447	4.37e-25	SMART
LDLa	452	486	2.31e-9	SMART
LDLa	487	523	4.08e-10	SMART
LDLa	524	561	3.98e-13	SMART
LDLa	566	604	1.48e-7	SMART
Tryp_SPc	614	849	1.25e-93	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133904

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148789

Predicted Effect

probably benign
Transcript: ENSMUST00000214418

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217404

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	A	T	8: 40,754,885	Y396F	probably benign	Het
Adra2a	T	A	19: 54,046,406	F64L	probably damaging	Het
Ankrd45	A	T	1: 161,151,300	N103I	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Bsn	A	G	9: 108,116,444	V703A	possibly damaging	Het
Btaf1	T	A	19: 36,972,957	I529K	probably damaging	Het
Ccdc110	A	G	8: 45,943,250	N726S	probably damaging	Het
Ccdc78	T	A	17: 25,787,070	S71T	probably damaging	Het
Cct5	G	T	15: 31,591,008	Q516K	probably benign	Het
Cd300c2	A	T	11: 115,000,859	V63E	probably benign	Het
Cdh16	A	G	8: 104,617,963	V7A	possibly damaging	Het
Clec16a	T	C	16: 10,688,539	F710L	probably damaging	Het
Clpb	T	G	7: 101,779,211	F393V	probably damaging	Het
Commd9	G	A	2: 101,901,031	R187H	probably damaging	Het
Crx	T	A	7: 15,868,376	K126*	probably null	Het
Dcaf13	T	A	15: 39,138,088	Y264N	probably damaging	Het
Dnah12	T	A	14: 26,734,495	I791N	probably damaging	Het
Dpy19l1	A	T	9: 24,434,387	D456E	probably damaging	Het
Dscam	A	G	16: 96,593,214	S1963P	probably benign	Het
Efl1	C	T	7: 82,763,117	Q905*	probably null	Het
Fam57b	T	A	7: 126,827,672		probably null	Het
Farsa	T	C	8: 84,861,151	F104L	probably benign	Het
Fbxl19	C	A	7: 127,750,929	A231E	probably benign	Het
Fbxw19	A	T	9: 109,481,650	N401K	probably benign	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,075,965		probably benign	Het
Frem3	A	G	8: 80,612,890	N604S	probably benign	Het
Gad1	T	G	2: 70,587,392	C312G	possibly damaging	Het
Garem2	G	T	5: 30,114,862	E441*	probably null	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm8206	A	T	14: 6,022,475	M8K	probably benign	Het
Gpr162	G	A	6: 124,861,447	S80F	probably damaging	Het
Grpr	C	A	X: 163,549,141	V53L	probably benign	Het
Il21	C	T	3: 37,232,486	R27H	probably benign	Het
Il21r	C	T	7: 125,628,981	T208I	possibly damaging	Het
Kcnab2	T	C	4: 152,435,866	T6A	possibly damaging	Het
Klra4	T	A	6: 130,065,244	Q20L	possibly damaging	Het
Lrrtm1	A	T	6: 77,244,966		probably null	Het
Lrrtm3	A	G	10: 64,088,513	F292L	possibly damaging	Het
Mpeg1	A	T	19: 12,462,647	K490*	probably null	Het
Myh14	C	T	7: 44,615,348	M1671I	probably benign	Het
Nebl	A	T	2: 17,375,292	M757K	probably damaging	Het
Olfr1110	T	A	2: 87,135,844	H159L	probably damaging	Het
Olfr504	A	C	7: 108,565,523	F91V	possibly damaging	Het
Olfr631	G	T	7: 103,929,130	M102I	probably damaging	Het
Pkhd1l1	A	T	15: 44,540,884	H2303L	possibly damaging	Het
Podxl2	C	T	6: 88,849,605	V240M	probably benign	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prss53	T	C	7: 127,886,262	*553W	probably null	Het
Psma3	T	A	12: 70,984,694	M43K	probably benign	Het
Rad50	G	T	11: 53,680,061	T790K	probably benign	Het
Rasgrf1	G	T	9: 89,953,913	Q231H	probably damaging	Het
Rpn1	T	A	6: 88,093,859	V237E	probably damaging	Het
Scn10a	T	A	9: 119,609,998	M1601L	probably damaging	Het
Sema4f	G	T	6: 82,930,927	P180Q	probably damaging	Het
Serpinb5	A	G	1: 106,876,121	E8G	probably damaging	Het
Sgcg	C	T	14: 61,232,412	V167I	possibly damaging	Het
Slc25a13	C	T	6: 6,109,262	V367M	probably damaging	Het
Spata31	T	C	13: 64,920,610	S191P	probably benign	Het
Srbd1	A	G	17: 86,102,893	V537A	probably damaging	Het
Srgap1	G	T	10: 121,925,903	D113E	possibly damaging	Het
Srl	A	G	16: 4,492,350	I505T	probably damaging	Het
Stard9	T	A	2: 120,698,656	I1798N	possibly damaging	Het
Sugp1	A	G	8: 70,056,575	E166G	possibly damaging	Het
Susd1	A	T	4: 59,351,695	N455K	possibly damaging	Het
Sytl3	T	A	17: 6,733,046	V205E	probably damaging	Het
Tenm4	A	G	7: 96,895,326	Y2183C	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tlr1	T	G	5: 64,925,438	T599P	possibly damaging	Het
Trpc6	G	A	9: 8,656,545	D658N	probably damaging	Het
Ttc39b	A	G	4: 83,232,720	V546A	possibly damaging	Het
Ube3c	T	C	5: 29,619,659	Y561H	probably damaging	Het
Vmn1r29	T	A	6: 58,307,420	S42T	probably benign	Het
Vps4a	T	C	8: 107,044,558	V392A	probably benign	Het
Wdfy4	T	C	14: 33,133,344	E771G	probably benign	Het
Whrn	G	A	4: 63,415,639	Q415*	probably null	Het
Wnt5a	C	T	14: 28,511,845	P10L	probably benign	Het
Zfhx2	T	C	14: 55,075,238		probably benign	Het
Zfp451	T	C	1: 33,777,822	K132R	probably damaging	Het

Other mutations in St14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:St14	APN	9	31103779	missense	probably damaging	1.00
IGL01443:St14	APN	9	31100193	nonsense	probably null
IGL01816:St14	APN	9	31108267	missense	possibly damaging	0.71
IGL02100:St14	APN	9	31100130	splice site	probably benign
IGL02494:St14	APN	9	31108645	missense	possibly damaging	0.47
IGL02588:St14	APN	9	31090033	splice site	probably benign
IGL02663:St14	APN	9	31100382	splice site	probably null
IGL02711:St14	APN	9	31089900	missense	probably benign	0.05
IGL03130:St14	APN	9	31097071	critical splice donor site	probably null
IGL03296:St14	APN	9	31108712	missense	probably damaging	0.98
IGL03400:St14	APN	9	31096971	splice site	probably benign
R0101:St14	UTSW	9	31097107	missense	probably benign	0.23
R0225:St14	UTSW	9	31108284	critical splice acceptor site	probably null
R0335:St14	UTSW	9	31091324	splice site	probably benign
R0892:St14	UTSW	9	31100428	missense	probably benign	0.38
R1334:St14	UTSW	9	31108210	missense	probably damaging	1.00
R1487:St14	UTSW	9	31097180	missense	probably damaging	1.00
R1521:St14	UTSW	9	31108215	missense	probably benign	0.03
R1782:St14	UTSW	9	31100164	missense	probably damaging	1.00
R1920:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1921:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1922:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R2070:St14	UTSW	9	31091373	missense	probably damaging	1.00
R2411:St14	UTSW	9	31108234	missense	probably benign	0.13
R4152:St14	UTSW	9	31090506	missense	probably benign	0.08
R4375:St14	UTSW	9	31090458	missense	probably benign	0.02
R4419:St14	UTSW	9	31096928	missense	probably damaging	1.00
R4747:St14	UTSW	9	31103757	missense	possibly damaging	0.78
R4791:St14	UTSW	9	31095622	missense	probably benign	0.27
R4915:St14	UTSW	9	31108664	nonsense	probably null
R5056:St14	UTSW	9	31097551	splice site	probably null
R5134:St14	UTSW	9	31095583	missense	probably benign	0.00
R5241:St14	UTSW	9	31100418	nonsense	probably null
R5325:St14	UTSW	9	31096978	splice site	probably null
R5644:St14	UTSW	9	31106510	missense	probably benign
R5828:St14	UTSW	9	31091507	missense	probably damaging	1.00
R5922:St14	UTSW	9	31129904	intron	probably benign
R5930:St14	UTSW	9	31103760	missense	probably damaging	1.00
R5963:St14	UTSW	9	31106557	intron	probably benign
R6911:St14	UTSW	9	31106785	missense	probably benign	0.00
R6937:St14	UTSW	9	31129660	intron	probably null
R6986:St14	UTSW	9	31096549	missense	probably damaging	0.98
R7226:St14	UTSW	9	31100152	missense	possibly damaging	0.63
R7395:St14	UTSW	9	31096899	missense	probably benign	0.29
R7400:St14	UTSW	9	31108275	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- ATGGGGCTCAGGCTATCATAC -3'
(R):5'- ATGGGGTCCCTAGAAGTCAGATG -3'

Sequencing Primer
(F):5'- CTCAGGCTATCATACACGGTG -3'
(R):5'- GGTACTGATGGACAAGCATCTCTTC -3'

Posted On

2014-07-14