Mutagenetix > Incidental Mutations

Incidental Mutation 'R1933:Scn10a'

215593

Institutional Source

Beutler Lab

Gene Symbol

Scn10a

Ensembl Gene

ENSMUSG00000034533

Gene Name

sodium channel, voltage-gated, type X, alpha

Synonyms

Nav1.8

MMRRC Submission

039951-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.322) question?

Stock #

R1933 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119608456-119719322 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119609998 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1601 (M1601L)

Ref Sequence

ENSEMBL: ENSMUSP00000148987 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084787] [ENSMUST00000213392] [ENSMUST00000214408]

Predicted Effect

probably benign
Transcript: ENSMUST00000084787
AA Change: M1602L

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000081845
Gene: ENSMUSG00000034533
AA Change: M1602L

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	129	406	7.9e-77	PFAM
low complexity region	557	572	N/A	INTRINSIC
Pfam:Ion_trans	663	898	6.8e-53	PFAM
Pfam:Na_trans_assoc	903	1148	2.7e-57	PFAM
Pfam:Ion_trans	1152	1429	8.1e-66	PFAM
Pfam:Ion_trans	1476	1734	1.9e-55	PFAM
Pfam:PKD_channel	1561	1729	3.4e-8	PFAM
IQ	1851	1873	7.57e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000213392
AA Change: M1601L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000214408
AA Change: M1602L

PolyPhen 2 Score 0.433 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tetrodotoxin-resistant voltage-gated sodium channel alpha subunit. The properties of the channel formed by the encoded transmembrane protein can be altered by interaction with different beta subunits. This protein may be involved in the onset of pain associated with peripheral neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired perception of pain. Mice homozygous or heterozygous for an ENU-induced allele exhibit a catalepsy phenotype following scruffing and increased sensitivity to cold pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	A	T	8: 40,754,885	Y396F	probably benign	Het
Adra2a	T	A	19: 54,046,406	F64L	probably damaging	Het
Ankrd45	A	T	1: 161,151,300	N103I	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Bsn	A	G	9: 108,116,444	V703A	possibly damaging	Het
Btaf1	T	A	19: 36,972,957	I529K	probably damaging	Het
Ccdc110	A	G	8: 45,943,250	N726S	probably damaging	Het
Ccdc78	T	A	17: 25,787,070	S71T	probably damaging	Het
Cct5	G	T	15: 31,591,008	Q516K	probably benign	Het
Cd300c2	A	T	11: 115,000,859	V63E	probably benign	Het
Cdh16	A	G	8: 104,617,963	V7A	possibly damaging	Het
Clec16a	T	C	16: 10,688,539	F710L	probably damaging	Het
Clpb	T	G	7: 101,779,211	F393V	probably damaging	Het
Commd9	G	A	2: 101,901,031	R187H	probably damaging	Het
Crx	T	A	7: 15,868,376	K126*	probably null	Het
Dcaf13	T	A	15: 39,138,088	Y264N	probably damaging	Het
Dnah12	T	A	14: 26,734,495	I791N	probably damaging	Het
Dpy19l1	A	T	9: 24,434,387	D456E	probably damaging	Het
Dscam	A	G	16: 96,593,214	S1963P	probably benign	Het
Efl1	C	T	7: 82,763,117	Q905*	probably null	Het
Fam57b	T	A	7: 126,827,672		probably null	Het
Farsa	T	C	8: 84,861,151	F104L	probably benign	Het
Fbxl19	C	A	7: 127,750,929	A231E	probably benign	Het
Fbxw19	A	T	9: 109,481,650	N401K	probably benign	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,075,965		probably benign	Het
Frem3	A	G	8: 80,612,890	N604S	probably benign	Het
Gad1	T	G	2: 70,587,392	C312G	possibly damaging	Het
Garem2	G	T	5: 30,114,862	E441*	probably null	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm8206	A	T	14: 6,022,475	M8K	probably benign	Het
Gpr162	G	A	6: 124,861,447	S80F	probably damaging	Het
Grpr	C	A	X: 163,549,141	V53L	probably benign	Het
Il21	C	T	3: 37,232,486	R27H	probably benign	Het
Il21r	C	T	7: 125,628,981	T208I	possibly damaging	Het
Kcnab2	T	C	4: 152,435,866	T6A	possibly damaging	Het
Klra4	T	A	6: 130,065,244	Q20L	possibly damaging	Het
Lrrtm1	A	T	6: 77,244,966		probably null	Het
Lrrtm3	A	G	10: 64,088,513	F292L	possibly damaging	Het
Mpeg1	A	T	19: 12,462,647	K490*	probably null	Het
Myh14	C	T	7: 44,615,348	M1671I	probably benign	Het
Nebl	A	T	2: 17,375,292	M757K	probably damaging	Het
Olfr1110	T	A	2: 87,135,844	H159L	probably damaging	Het
Olfr504	A	C	7: 108,565,523	F91V	possibly damaging	Het
Olfr631	G	T	7: 103,929,130	M102I	probably damaging	Het
Pkhd1l1	A	T	15: 44,540,884	H2303L	possibly damaging	Het
Podxl2	C	T	6: 88,849,605	V240M	probably benign	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prss53	T	C	7: 127,886,262	*553W	probably null	Het
Psma3	T	A	12: 70,984,694	M43K	probably benign	Het
Rad50	G	T	11: 53,680,061	T790K	probably benign	Het
Rasgrf1	G	T	9: 89,953,913	Q231H	probably damaging	Het
Rpn1	T	A	6: 88,093,859	V237E	probably damaging	Het
Sema4f	G	T	6: 82,930,927	P180Q	probably damaging	Het
Serpinb5	A	G	1: 106,876,121	E8G	probably damaging	Het
Sgcg	C	T	14: 61,232,412	V167I	possibly damaging	Het
Slc25a13	C	T	6: 6,109,262	V367M	probably damaging	Het
Spata31	T	C	13: 64,920,610	S191P	probably benign	Het
Srbd1	A	G	17: 86,102,893	V537A	probably damaging	Het
Srgap1	G	T	10: 121,925,903	D113E	possibly damaging	Het
Srl	A	G	16: 4,492,350	I505T	probably damaging	Het
St14	G	A	9: 31,106,212	T226I	probably benign	Het
Stard9	T	A	2: 120,698,656	I1798N	possibly damaging	Het
Sugp1	A	G	8: 70,056,575	E166G	possibly damaging	Het
Susd1	A	T	4: 59,351,695	N455K	possibly damaging	Het
Sytl3	T	A	17: 6,733,046	V205E	probably damaging	Het
Tenm4	A	G	7: 96,895,326	Y2183C	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tlr1	T	G	5: 64,925,438	T599P	possibly damaging	Het
Trpc6	G	A	9: 8,656,545	D658N	probably damaging	Het
Ttc39b	A	G	4: 83,232,720	V546A	possibly damaging	Het
Ube3c	T	C	5: 29,619,659	Y561H	probably damaging	Het
Vmn1r29	T	A	6: 58,307,420	S42T	probably benign	Het
Vps4a	T	C	8: 107,044,558	V392A	probably benign	Het
Wdfy4	T	C	14: 33,133,344	E771G	probably benign	Het
Whrn	G	A	4: 63,415,639	Q415*	probably null	Het
Wnt5a	C	T	14: 28,511,845	P10L	probably benign	Het
Zfhx2	T	C	14: 55,075,238		probably benign	Het
Zfp451	T	C	1: 33,777,822	K132R	probably damaging	Het

Other mutations in Scn10a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Scn10a	APN	9	119672226	missense	probably damaging	1.00
IGL01339:Scn10a	APN	9	119622766	missense	probably damaging	1.00
IGL01467:Scn10a	APN	9	119658412	missense	probably benign	0.33
IGL01472:Scn10a	APN	9	119617763	missense	probably damaging	1.00
IGL01481:Scn10a	APN	9	119609194	missense	probably damaging	1.00
IGL01539:Scn10a	APN	9	119638698	missense	probably damaging	0.99
IGL01580:Scn10a	APN	9	119627159	missense	probably damaging	1.00
IGL01676:Scn10a	APN	9	119672165	nonsense	probably null
IGL01681:Scn10a	APN	9	119694077	missense	probably damaging	1.00
IGL01748:Scn10a	APN	9	119627084	missense	probably damaging	1.00
IGL01866:Scn10a	APN	9	119635502	nonsense	probably null
IGL01998:Scn10a	APN	9	119609676	missense	probably damaging	1.00
IGL02015:Scn10a	APN	9	119664951	missense	probably benign	0.09
IGL02098:Scn10a	APN	9	119691478	missense	possibly damaging	0.90
IGL02113:Scn10a	APN	9	119609890	missense	probably damaging	1.00
IGL02245:Scn10a	APN	9	119672152	missense	probably damaging	1.00
IGL02262:Scn10a	APN	9	119658433	missense	possibly damaging	0.92
IGL02317:Scn10a	APN	9	119638555	missense	probably benign	0.00
IGL02428:Scn10a	APN	9	119691562	missense	probably damaging	1.00
IGL02439:Scn10a	APN	9	119618848	missense	probably benign	0.40
IGL02583:Scn10a	APN	9	119691440	splice site	probably benign
IGL02597:Scn10a	APN	9	119610123	missense	probably damaging	0.99
IGL02680:Scn10a	APN	9	119666059	missense	probably damaging	1.00
IGL02733:Scn10a	APN	9	119616705	missense	probably damaging	1.00
IGL02851:Scn10a	APN	9	119671608	missense	probably damaging	1.00
IGL02992:Scn10a	APN	9	119609560	missense	possibly damaging	0.90
IGL03040:Scn10a	APN	9	119622985	missense	probably damaging	1.00
IGL03049:Scn10a	APN	9	119665990	missense	probably damaging	1.00
IGL03407:Scn10a	APN	9	119648171	missense	probably damaging	0.99
Possum	UTSW	9	119638705	missense	probably damaging	1.00
R0025:Scn10a	UTSW	9	119670484	missense	probably damaging	1.00
R0030:Scn10a	UTSW	9	119669990	missense	probably benign	0.01
R0328:Scn10a	UTSW	9	119694102	missense	possibly damaging	0.92
R0494:Scn10a	UTSW	9	119624100	missense	probably damaging	1.00
R0511:Scn10a	UTSW	9	119613700	missense	probably damaging	0.99
R0548:Scn10a	UTSW	9	119665928	missense	probably benign	0.00
R0584:Scn10a	UTSW	9	119670531	missense	probably damaging	1.00
R0595:Scn10a	UTSW	9	119666063	missense	probably benign	0.01
R0894:Scn10a	UTSW	9	119630147	missense	probably damaging	1.00
R1022:Scn10a	UTSW	9	119609274	missense	probably damaging	1.00
R1024:Scn10a	UTSW	9	119609274	missense	probably damaging	1.00
R1263:Scn10a	UTSW	9	119617733	missense	probably damaging	1.00
R1456:Scn10a	UTSW	9	119691478	missense	probably benign	0.01
R1466:Scn10a	UTSW	9	119666490	missense	probably damaging	1.00
R1466:Scn10a	UTSW	9	119666490	missense	probably damaging	1.00
R1573:Scn10a	UTSW	9	119613626	missense	probably benign	0.04
R1704:Scn10a	UTSW	9	119609394	missense	probably damaging	1.00
R1945:Scn10a	UTSW	9	119691454	missense	possibly damaging	0.91
R2013:Scn10a	UTSW	9	119613736	missense	probably damaging	0.99
R2155:Scn10a	UTSW	9	119609448	missense	probably benign	0.02
R2196:Scn10a	UTSW	9	119609004	missense	probably benign
R2231:Scn10a	UTSW	9	119633850	missense	possibly damaging	0.73
R2353:Scn10a	UTSW	9	119638687	missense	probably damaging	1.00
R2392:Scn10a	UTSW	9	119627202	missense	possibly damaging	0.86
R2895:Scn10a	UTSW	9	119661401	missense	probably benign	0.00
R2926:Scn10a	UTSW	9	119638701	missense	possibly damaging	0.93
R3783:Scn10a	UTSW	9	119691562	missense	probably damaging	1.00
R3821:Scn10a	UTSW	9	119638633	missense	probably benign
R4003:Scn10a	UTSW	9	119608968	missense	probably null	0.00
R4208:Scn10a	UTSW	9	119616776	missense	probably damaging	0.99
R4231:Scn10a	UTSW	9	119631544	missense	probably damaging	0.98
R4626:Scn10a	UTSW	9	119631505	missense	possibly damaging	0.87
R4702:Scn10a	UTSW	9	119633791	missense	possibly damaging	0.59
R4713:Scn10a	UTSW	9	119609651	missense	probably damaging	1.00
R4729:Scn10a	UTSW	9	119671526	missense	probably damaging	1.00
R4782:Scn10a	UTSW	9	119622910	missense	possibly damaging	0.70
R4822:Scn10a	UTSW	9	119638672	missense	probably damaging	1.00
R4856:Scn10a	UTSW	9	119694309	missense	possibly damaging	0.46
R4856:Scn10a	UTSW	9	119694310	missense	possibly damaging	0.63
R4932:Scn10a	UTSW	9	119687874	splice site	probably null
R5015:Scn10a	UTSW	9	119622921	missense	possibly damaging	0.93
R5193:Scn10a	UTSW	9	119609655	missense	probably damaging	1.00
R5211:Scn10a	UTSW	9	119661232	missense	possibly damaging	0.87
R5320:Scn10a	UTSW	9	119648109	missense	probably damaging	1.00
R5400:Scn10a	UTSW	9	119609034	missense	probably damaging	0.99
R5448:Scn10a	UTSW	9	119687947	missense	probably benign	0.25
R5457:Scn10a	UTSW	9	119694127	missense	probably damaging	1.00
R5554:Scn10a	UTSW	9	119694130	missense	probably benign	0.01
R5680:Scn10a	UTSW	9	119624136	missense	probably damaging	1.00
R5762:Scn10a	UTSW	9	119635441	critical splice donor site	probably null
R5935:Scn10a	UTSW	9	119627171	missense	probably damaging	0.99
R5956:Scn10a	UTSW	9	119631560	missense	probably damaging	1.00
R6041:Scn10a	UTSW	9	119609469	missense	probably damaging	1.00
R6047:Scn10a	UTSW	9	119622831	missense	probably benign	0.20
R6132:Scn10a	UTSW	9	119613695	missense	possibly damaging	0.94
R6156:Scn10a	UTSW	9	119635583	missense	probably benign	0.00
R6309:Scn10a	UTSW	9	119624115	missense	possibly damaging	0.95
R6318:Scn10a	UTSW	9	119627115	missense	probably damaging	1.00
R6394:Scn10a	UTSW	9	119661320	missense	probably benign	0.36
R6711:Scn10a	UTSW	9	119609913	missense	probably damaging	1.00
R6751:Scn10a	UTSW	9	119671551	missense	probably damaging	1.00
R6877:Scn10a	UTSW	9	119609782	missense	probably damaging	0.96
R6909:Scn10a	UTSW	9	119609790	missense	probably damaging	1.00
X0058:Scn10a	UTSW	9	119609364	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTGATCTGGAAAAGGCAC -3'
(R):5'- ACTGAGAAATGTGATCACGGCC -3'

Sequencing Primer
(F):5'- CAGCATGCTGTTGCCAAAG -3'
(R):5'- TGTGATCACGGCCAGCCTAATC -3'

Posted On

2014-07-14