Mutagenetix > Incidental Mutation

Incidental Mutation 'R1933:Rad50'

215598

Institutional Source

Beutler Lab

Gene Symbol

Rad50

Ensembl Gene

ENSMUSG00000020380

Gene Name

RAD50 double strand break repair protein

Synonyms

Rad50l, Mrell

MMRRC Submission

039951-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1933 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53649519-53707319 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 53680061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 790 (T790K)

Ref Sequence

ENSEMBL: ENSMUSP00000020649 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020649] [ENSMUST00000124352] [ENSMUST00000128483]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000020649
AA Change: T790K

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000020649
Gene: ENSMUSG00000020380
AA Change: T790K

Domain	Start	End	E-Value	Type
Pfam:AAA_23	6	295	1.8e-31	PFAM
coiled coil region	397	534	N/A	INTRINSIC
Pfam:Rad50_zn_hook	659	712	9.9e-16	PFAM
low complexity region	825	836	N/A	INTRINSIC
low complexity region	919	929	N/A	INTRINSIC
coiled coil region	1019	1075	N/A	INTRINSIC
Pfam:SbcCD_C	1174	1251	1.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124352

SMART Domains

Protein: ENSMUSP00000119618
Gene: ENSMUSG00000020380

Domain	Start	End	E-Value	Type
Pfam:AAA_23	6	290	2.7e-24	PFAM
coiled coil region	397	469	N/A	INTRINSIC
Pfam:Rad50_zn_hook	597	652	1.9e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126121

Predicted Effect

probably benign
Transcript: ENSMUST00000128483

SMART Domains

Protein: ENSMUSP00000120869
Gene: ENSMUSG00000020380

Domain	Start	End	E-Value	Type
Pfam:AAA_23	6	295	6e-23	PFAM
coiled coil region	397	534	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a targeted hypomorphic mutation exhibit growth defects, predisposition toward cancer, progressive loss of hematopoietic and spermatogenic stem cells, and lethality due to bone marrow depletion. A null mutation results in embryonic death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam25	A	T	8: 40,754,885	Y396F	probably benign	Het
Adra2a	T	A	19: 54,046,406	F64L	probably damaging	Het
Ankrd45	A	T	1: 161,151,300	N103I	probably damaging	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Bsn	A	G	9: 108,116,444	V703A	possibly damaging	Het
Btaf1	T	A	19: 36,972,957	I529K	probably damaging	Het
Ccdc110	A	G	8: 45,943,250	N726S	probably damaging	Het
Ccdc78	T	A	17: 25,787,070	S71T	probably damaging	Het
Cct5	G	T	15: 31,591,008	Q516K	probably benign	Het
Cd300c2	A	T	11: 115,000,859	V63E	probably benign	Het
Cdh16	A	G	8: 104,617,963	V7A	possibly damaging	Het
Clec16a	T	C	16: 10,688,539	F710L	probably damaging	Het
Clpb	T	G	7: 101,779,211	F393V	probably damaging	Het
Commd9	G	A	2: 101,901,031	R187H	probably damaging	Het
Crx	T	A	7: 15,868,376	K126*	probably null	Het
Dcaf13	T	A	15: 39,138,088	Y264N	probably damaging	Het
Dnah12	T	A	14: 26,734,495	I791N	probably damaging	Het
Dpy19l1	A	T	9: 24,434,387	D456E	probably damaging	Het
Dscam	A	G	16: 96,593,214	S1963P	probably benign	Het
Efl1	C	T	7: 82,763,117	Q905*	probably null	Het
Fam57b	T	A	7: 126,827,672		probably null	Het
Farsa	T	C	8: 84,861,151	F104L	probably benign	Het
Fbxl19	C	A	7: 127,750,929	A231E	probably benign	Het
Fbxw19	A	T	9: 109,481,650	N401K	probably benign	Het
Foxp1	TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG	6: 99,075,965		probably benign	Het
Frem3	A	G	8: 80,612,890	N604S	probably benign	Het
Gad1	T	G	2: 70,587,392	C312G	possibly damaging	Het
Garem2	G	T	5: 30,114,862	E441*	probably null	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm8206	A	T	14: 6,022,475	M8K	probably benign	Het
Gpr162	G	A	6: 124,861,447	S80F	probably damaging	Het
Grpr	C	A	X: 163,549,141	V53L	probably benign	Het
Il21	C	T	3: 37,232,486	R27H	probably benign	Het
Il21r	C	T	7: 125,628,981	T208I	possibly damaging	Het
Kcnab2	T	C	4: 152,435,866	T6A	possibly damaging	Het
Klra4	T	A	6: 130,065,244	Q20L	possibly damaging	Het
Lrrtm1	A	T	6: 77,244,966		probably null	Het
Lrrtm3	A	G	10: 64,088,513	F292L	possibly damaging	Het
Mpeg1	A	T	19: 12,462,647	K490*	probably null	Het
Myh14	C	T	7: 44,615,348	M1671I	probably benign	Het
Nebl	A	T	2: 17,375,292	M757K	probably damaging	Het
Olfr1110	T	A	2: 87,135,844	H159L	probably damaging	Het
Olfr504	A	C	7: 108,565,523	F91V	possibly damaging	Het
Olfr631	G	T	7: 103,929,130	M102I	probably damaging	Het
Pkhd1l1	A	T	15: 44,540,884	H2303L	possibly damaging	Het
Podxl2	C	T	6: 88,849,605	V240M	probably benign	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prss53	T	C	7: 127,886,262	*553W	probably null	Het
Psma3	T	A	12: 70,984,694	M43K	probably benign	Het
Rasgrf1	G	T	9: 89,953,913	Q231H	probably damaging	Het
Rpn1	T	A	6: 88,093,859	V237E	probably damaging	Het
Scn10a	T	A	9: 119,609,998	M1601L	probably damaging	Het
Sema4f	G	T	6: 82,930,927	P180Q	probably damaging	Het
Serpinb5	A	G	1: 106,876,121	E8G	probably damaging	Het
Sgcg	C	T	14: 61,232,412	V167I	possibly damaging	Het
Slc25a13	C	T	6: 6,109,262	V367M	probably damaging	Het
Spata31	T	C	13: 64,920,610	S191P	probably benign	Het
Srbd1	A	G	17: 86,102,893	V537A	probably damaging	Het
Srgap1	G	T	10: 121,925,903	D113E	possibly damaging	Het
Srl	A	G	16: 4,492,350	I505T	probably damaging	Het
St14	G	A	9: 31,106,212	T226I	probably benign	Het
Stard9	T	A	2: 120,698,656	I1798N	possibly damaging	Het
Sugp1	A	G	8: 70,056,575	E166G	possibly damaging	Het
Susd1	A	T	4: 59,351,695	N455K	possibly damaging	Het
Sytl3	T	A	17: 6,733,046	V205E	probably damaging	Het
Tenm4	A	G	7: 96,895,326	Y2183C	probably damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tlr1	T	G	5: 64,925,438	T599P	possibly damaging	Het
Trpc6	G	A	9: 8,656,545	D658N	probably damaging	Het
Ttc39b	A	G	4: 83,232,720	V546A	possibly damaging	Het
Ube3c	T	C	5: 29,619,659	Y561H	probably damaging	Het
Vmn1r29	T	A	6: 58,307,420	S42T	probably benign	Het
Vps4a	T	C	8: 107,044,558	V392A	probably benign	Het
Wdfy4	T	C	14: 33,133,344	E771G	probably benign	Het
Whrn	G	A	4: 63,415,639	Q415*	probably null	Het
Wnt5a	C	T	14: 28,511,845	P10L	probably benign	Het
Zfhx2	T	C	14: 55,075,238		probably benign	Het
Zfp451	T	C	1: 33,777,822	K132R	probably damaging	Het

Other mutations in Rad50

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00477:Rad50	APN	11	53686311	intron	probably benign
IGL00709:Rad50	APN	11	53669642	missense	possibly damaging	0.49
IGL01080:Rad50	APN	11	53706068	missense	probably damaging	1.00
IGL01357:Rad50	APN	11	53707021	missense	probably damaging	1.00
IGL01979:Rad50	APN	11	53686178	nonsense	probably null
IGL02481:Rad50	APN	11	53680049	missense	probably benign	0.20
IGL02483:Rad50	APN	11	53680049	missense	probably benign	0.20
IGL02673:Rad50	APN	11	53688240	missense	probably benign	0.19
IGL02754:Rad50	APN	11	53702056	missense	probably damaging	1.00
IGL03372:Rad50	APN	11	53695294	missense	probably benign	0.20
PIT4131001:Rad50	UTSW	11	53694899	critical splice donor site	probably null
R0035:Rad50	UTSW	11	53655027	splice site	probably benign
R0035:Rad50	UTSW	11	53655027	splice site	probably benign
R0270:Rad50	UTSW	11	53668025	missense	probably damaging	1.00
R0373:Rad50	UTSW	11	53650519	missense	probably damaging	1.00
R0567:Rad50	UTSW	11	53654956	missense	probably damaging	1.00
R1132:Rad50	UTSW	11	53694961	missense	possibly damaging	0.58
R1249:Rad50	UTSW	11	53692137	missense	probably damaging	0.99
R1368:Rad50	UTSW	11	53683245	nonsense	probably null
R1501:Rad50	UTSW	11	53688151	missense	possibly damaging	0.68
R1506:Rad50	UTSW	11	53679485	missense	probably damaging	0.98
R1633:Rad50	UTSW	11	53692859	missense	probably benign	0.00
R1663:Rad50	UTSW	11	53668223	missense	probably benign	0.01
R1847:Rad50	UTSW	11	53702107	missense	possibly damaging	0.68
R2176:Rad50	UTSW	11	53698209	missense	probably benign	0.00
R2519:Rad50	UTSW	11	53707185	start gained	probably benign
R3027:Rad50	UTSW	11	53695381	missense	probably benign	0.00
R3894:Rad50	UTSW	11	53678870	missense	probably benign	0.01
R4181:Rad50	UTSW	11	53702005	missense	probably benign	0.00
R4302:Rad50	UTSW	11	53702005	missense	probably benign	0.00
R4836:Rad50	UTSW	11	53650653	missense	probably damaging	1.00
R4934:Rad50	UTSW	11	53684275	missense	probably benign	0.05
R5047:Rad50	UTSW	11	53674696	critical splice donor site	probably null
R5201:Rad50	UTSW	11	53698820	critical splice donor site	probably null
R5325:Rad50	UTSW	11	53692863	missense	probably benign	0.16
R5368:Rad50	UTSW	11	53684246	missense	probably benign	0.02
R5403:Rad50	UTSW	11	53695281	critical splice donor site	probably null
R5421:Rad50	UTSW	11	53674946	missense	probably benign	0.02
R6282:Rad50	UTSW	11	53669770	splice site	probably null
R6468:Rad50	UTSW	11	53692144	missense	possibly damaging	0.81
R6469:Rad50	UTSW	11	53684235	missense	probably benign	0.08
R6528:Rad50	UTSW	11	53652282	missense	probably damaging	1.00
R6704:Rad50	UTSW	11	53698918	missense	probably damaging	1.00
R6886:Rad50	UTSW	11	53686184	missense	probably benign	0.01
R7055:Rad50	UTSW	11	53688102	missense	probably benign	0.02
R7268:Rad50	UTSW	11	53684275	missense	probably benign	0.01
R7288:Rad50	UTSW	11	53654949	nonsense	probably null
R7375:Rad50	UTSW	11	53652228	splice site	probably null
R7380:Rad50	UTSW	11	53695396	missense	probably benign	0.00
R7467:Rad50	UTSW	11	53654908	missense	probably damaging	1.00
R7533:Rad50	UTSW	11	53698919	missense	probably damaging	1.00
R8289:Rad50	UTSW	11	53698858	nonsense	probably null
R8345:Rad50	UTSW	11	53684141	missense	probably benign	0.00
R8368:Rad50	UTSW	11	53683328	missense	possibly damaging	0.83
R8514:Rad50	UTSW	11	53678939	nonsense	probably null
R8986:Rad50	UTSW	11	53650527	missense	possibly damaging	0.64
R9182:Rad50	UTSW	11	53692763	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTACTATGCGCACGTGTG -3'
(R):5'- GTGTTTTCTTTTAAGGCAAAGCATA -3'

Sequencing Primer
(F):5'- CACTTGCTATATAGACCAGGCTGG -3'
(R):5'- AAGCATAATTGATTTGAAGGAAAAGG -3'

Posted On

2014-07-14