Incidental Mutation 'R0129:Tnrc18'
ID 21560
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Name trinucleotide repeat containing 18
Synonyms EG381742, Zfp469
MMRRC Submission 038414-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.787) question?
Stock # R0129 (G1)
Quality Score 200
Status Validated
Chromosome 5
Chromosomal Location 142710416-142803417 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 142750800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000151477
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152247
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477

DomainStartEndE-ValueType
low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200371
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,920,265 (GRCm39) D31G probably damaging Het
Actr2 A G 11: 20,050,939 (GRCm39) probably benign Het
Adcy8 A G 15: 64,618,862 (GRCm39) C764R probably benign Het
Ago4 A C 4: 126,410,976 (GRCm39) F171C possibly damaging Het
Akt2 T C 7: 27,336,395 (GRCm39) F408S probably damaging Het
Ankrd24 T C 10: 81,474,163 (GRCm39) L26P probably damaging Het
Appl1 A T 14: 26,650,600 (GRCm39) M524K probably damaging Het
Arhgef11 T A 3: 87,635,370 (GRCm39) I922N probably damaging Het
Atp5pd T C 11: 115,308,744 (GRCm39) E47G probably damaging Het
Birc6 A G 17: 74,835,755 (GRCm39) D70G probably benign Het
Bola2 G A 7: 126,295,731 (GRCm39) V56M probably damaging Het
Cd300lg A G 11: 101,944,918 (GRCm39) probably null Het
Cdc42bpb A G 12: 111,271,393 (GRCm39) probably benign Het
Ceacam20 A G 7: 19,710,185 (GRCm39) N403S probably damaging Het
Cenpf T C 1: 189,391,847 (GRCm39) M662V probably benign Het
Chd3 C A 11: 69,239,327 (GRCm39) E1607* probably null Het
Chtf18 A T 17: 25,946,285 (GRCm39) Y9* probably null Het
Clta A G 4: 44,032,424 (GRCm39) N200S probably benign Het
Csmd1 G A 8: 16,129,956 (GRCm39) S1722F possibly damaging Het
Cyria C T 12: 12,412,350 (GRCm39) T204I probably damaging Het
Dennd4a T C 9: 64,800,576 (GRCm39) S905P probably damaging Het
Dhx57 T C 17: 80,546,343 (GRCm39) K1347R probably damaging Het
Dmc1 A T 15: 79,480,441 (GRCm39) probably benign Het
Dnhd1 G T 7: 105,370,131 (GRCm39) A4519S probably benign Het
Dnmbp A G 19: 43,838,466 (GRCm39) C1120R probably benign Het
Efs C T 14: 55,154,680 (GRCm39) A427T probably damaging Het
Erich6 T C 3: 58,531,799 (GRCm39) E399G probably damaging Het
Espl1 A G 15: 102,225,083 (GRCm39) T1431A probably benign Het
Fam184b A G 5: 45,690,120 (GRCm39) S830P probably damaging Het
Herc1 T A 9: 66,355,357 (GRCm39) C2203S probably damaging Het
Itpr1 G A 6: 108,326,637 (GRCm39) V120M probably damaging Het
Kcnh7 G A 2: 62,546,503 (GRCm39) T1026I probably benign Het
Kif1b A G 4: 149,345,658 (GRCm39) I394T probably benign Het
Ldlrap1 A C 4: 134,484,733 (GRCm39) V87G probably damaging Het
Lgals12 C T 19: 7,580,403 (GRCm39) V155I probably damaging Het
Limch1 A T 5: 67,116,933 (GRCm39) N116I probably damaging Het
Lonp2 C T 8: 87,361,518 (GRCm39) R232C probably damaging Het
Lrch1 C A 14: 75,073,186 (GRCm39) C151F probably benign Het
Lrig3 A G 10: 125,842,812 (GRCm39) Y579C probably damaging Het
Macf1 T C 4: 123,327,068 (GRCm39) S4808G probably damaging Het
Mapkap1 A T 2: 34,513,494 (GRCm39) K501N probably damaging Het
Mdc1 G T 17: 36,165,337 (GRCm39) R1523L probably benign Het
Mlh3 C T 12: 85,312,914 (GRCm39) probably benign Het
Mul1 T C 4: 138,165,032 (GRCm39) probably benign Het
Mybl2 G A 2: 162,901,411 (GRCm39) probably benign Het
Notch1 G C 2: 26,350,470 (GRCm39) H2223Q probably benign Het
Notch2 C A 3: 98,053,936 (GRCm39) L2200M probably benign Het
Odad3 G T 9: 21,904,848 (GRCm39) R313S probably damaging Het
Or10ak8 A T 4: 118,774,667 (GRCm39) probably null Het
Or12k5 G A 2: 36,895,057 (GRCm39) R190* probably null Het
Or5ae2 T A 7: 84,506,196 (GRCm39) F206L probably benign Het
Or8a1b T C 9: 37,623,236 (GRCm39) Y113C probably damaging Het
Plekhs1 T C 19: 56,465,722 (GRCm39) probably null Het
Ppm1h G A 10: 122,777,260 (GRCm39) G509R probably damaging Het
Ppp2r3c C T 12: 55,345,207 (GRCm39) E94K probably damaging Het
Ppp2r5e T A 12: 75,509,164 (GRCm39) I372F probably damaging Het
Ptprt G A 2: 162,119,990 (GRCm39) T159I probably benign Het
Rab20 A G 8: 11,504,415 (GRCm39) F95S probably damaging Het
Rfc3 A C 5: 151,574,616 (GRCm39) M1R probably null Het
Skp2 A G 15: 9,125,280 (GRCm39) S100P probably damaging Het
Smg5 T C 3: 88,256,540 (GRCm39) S269P probably benign Het
Sspo A T 6: 48,432,352 (GRCm39) T684S probably benign Het
Syt3 A G 7: 44,042,782 (GRCm39) K355E probably damaging Het
Tcp10a A T 17: 7,610,903 (GRCm39) K355N probably damaging Het
Tsfm A G 10: 126,866,339 (GRCm39) L74P probably benign Het
Ttn G C 2: 76,564,609 (GRCm39) N28509K probably damaging Het
Ube2l6 G A 2: 84,629,252 (GRCm39) M1I probably null Het
Vmn2r80 T A 10: 79,005,330 (GRCm39) H322Q probably damaging Het
Zkscan8 A T 13: 21,706,441 (GRCm39) S212T probably benign Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142,748,792 (GRCm39) missense unknown
IGL01732:Tnrc18 APN 5 142,757,816 (GRCm39) missense unknown
IGL01796:Tnrc18 APN 5 142,750,642 (GRCm39) missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142,757,567 (GRCm39) missense unknown
IGL02010:Tnrc18 APN 5 142,773,049 (GRCm39) missense unknown
IGL02566:Tnrc18 APN 5 142,758,068 (GRCm39) splice site probably benign
IGL02688:Tnrc18 APN 5 142,775,927 (GRCm39) missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142,760,974 (GRCm39) missense unknown
R0617:Tnrc18 UTSW 5 142,762,494 (GRCm39) missense unknown
R0894:Tnrc18 UTSW 5 142,800,869 (GRCm39) missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142,759,614 (GRCm39) nonsense probably null
R1084:Tnrc18 UTSW 5 142,750,522 (GRCm39) critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142,772,963 (GRCm39) missense unknown
R1411:Tnrc18 UTSW 5 142,751,702 (GRCm39) missense unknown
R1443:Tnrc18 UTSW 5 142,757,288 (GRCm39) missense unknown
R1681:Tnrc18 UTSW 5 142,759,572 (GRCm39) missense unknown
R1698:Tnrc18 UTSW 5 142,774,458 (GRCm39) missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142,800,869 (GRCm39) missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142,800,895 (GRCm39) missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142,762,079 (GRCm39) missense unknown
R1931:Tnrc18 UTSW 5 142,762,079 (GRCm39) missense unknown
R1941:Tnrc18 UTSW 5 142,800,905 (GRCm39) missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142,751,842 (GRCm39) missense unknown
R2074:Tnrc18 UTSW 5 142,745,461 (GRCm39) splice site probably null
R2089:Tnrc18 UTSW 5 142,759,396 (GRCm39) missense unknown
R2091:Tnrc18 UTSW 5 142,759,396 (GRCm39) missense unknown
R2091:Tnrc18 UTSW 5 142,759,396 (GRCm39) missense unknown
R2182:Tnrc18 UTSW 5 142,745,816 (GRCm39) missense unknown
R2190:Tnrc18 UTSW 5 142,761,644 (GRCm39) missense unknown
R2310:Tnrc18 UTSW 5 142,774,308 (GRCm39) missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142,745,459 (GRCm39) splice site probably benign
R2445:Tnrc18 UTSW 5 142,757,870 (GRCm39) missense unknown
R3806:Tnrc18 UTSW 5 142,773,029 (GRCm39) missense unknown
R4097:Tnrc18 UTSW 5 142,759,561 (GRCm39) small deletion probably benign
R4153:Tnrc18 UTSW 5 142,751,747 (GRCm39) missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142,729,405 (GRCm39) missense unknown
R4520:Tnrc18 UTSW 5 142,717,905 (GRCm39) missense unknown
R4627:Tnrc18 UTSW 5 142,725,883 (GRCm39) missense unknown
R4852:Tnrc18 UTSW 5 142,717,095 (GRCm39) missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142,750,932 (GRCm39) missense unknown
R4875:Tnrc18 UTSW 5 142,750,932 (GRCm39) missense unknown
R4876:Tnrc18 UTSW 5 142,717,380 (GRCm39) missense unknown
R4936:Tnrc18 UTSW 5 142,751,732 (GRCm39) nonsense probably null
R4942:Tnrc18 UTSW 5 142,773,737 (GRCm39) missense unknown
R4962:Tnrc18 UTSW 5 142,725,248 (GRCm39) missense unknown
R5373:Tnrc18 UTSW 5 142,725,911 (GRCm39) missense unknown
R5374:Tnrc18 UTSW 5 142,725,911 (GRCm39) missense unknown
R5454:Tnrc18 UTSW 5 142,757,446 (GRCm39) missense unknown
R5678:Tnrc18 UTSW 5 142,719,319 (GRCm39) missense unknown
R5826:Tnrc18 UTSW 5 142,759,502 (GRCm39) missense unknown
R5891:Tnrc18 UTSW 5 142,800,926 (GRCm39) missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142,750,928 (GRCm39) missense unknown
R6296:Tnrc18 UTSW 5 142,719,331 (GRCm39) missense unknown
R6358:Tnrc18 UTSW 5 142,713,736 (GRCm39) missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142,712,767 (GRCm39) missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142,717,923 (GRCm39) missense unknown
R6711:Tnrc18 UTSW 5 142,773,545 (GRCm39) missense unknown
R6782:Tnrc18 UTSW 5 142,773,063 (GRCm39) missense unknown
R6863:Tnrc18 UTSW 5 142,800,952 (GRCm39) missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142,745,804 (GRCm39) missense unknown
R6970:Tnrc18 UTSW 5 142,713,744 (GRCm39) missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142,772,984 (GRCm39) missense unknown
R7135:Tnrc18 UTSW 5 142,773,572 (GRCm39) missense
R7756:Tnrc18 UTSW 5 142,772,907 (GRCm39) missense
R7902:Tnrc18 UTSW 5 142,757,902 (GRCm39) missense
R8039:Tnrc18 UTSW 5 142,717,807 (GRCm39) missense unknown
R8053:Tnrc18 UTSW 5 142,736,385 (GRCm39) missense unknown
R8322:Tnrc18 UTSW 5 142,711,767 (GRCm39) missense probably damaging 1.00
R8379:Tnrc18 UTSW 5 142,774,157 (GRCm39) missense
R8745:Tnrc18 UTSW 5 142,773,202 (GRCm39) missense
R8837:Tnrc18 UTSW 5 142,778,811 (GRCm39) missense possibly damaging 0.94
R8894:Tnrc18 UTSW 5 142,725,212 (GRCm39) missense unknown
R8909:Tnrc18 UTSW 5 142,762,131 (GRCm39) missense
R9030:Tnrc18 UTSW 5 142,711,818 (GRCm39) missense probably damaging 1.00
R9186:Tnrc18 UTSW 5 142,773,488 (GRCm39) missense
R9189:Tnrc18 UTSW 5 142,717,107 (GRCm39) missense probably damaging 1.00
R9192:Tnrc18 UTSW 5 142,773,602 (GRCm39) missense
R9227:Tnrc18 UTSW 5 142,773,392 (GRCm39) missense
R9230:Tnrc18 UTSW 5 142,773,392 (GRCm39) missense
R9582:Tnrc18 UTSW 5 142,757,128 (GRCm39) missense
RF022:Tnrc18 UTSW 5 142,759,385 (GRCm39) missense
Z1177:Tnrc18 UTSW 5 142,759,643 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TCGGGTTAGAGTTAAGCCACTGAGG -3'
(R):5'- TGGGATTCAAGCATCAGCAGACAG -3'

Sequencing Primer
(F):5'- GTTCAGGGATCAGAACGCC -3'
(R):5'- GCATCAGCAGACAGCATTC -3'
Posted On 2013-04-11