Incidental Mutation 'R1933:Dscam'
ID215621
Institutional Source Beutler Lab
Gene Symbol Dscam
Ensembl Gene ENSMUSG00000050272
Gene NameDS cell adhesion molecule
Synonyms4932410A21Rik
MMRRC Submission 039951-MU
Accession Numbers

Genbank: NM_031174; MGI: 1196281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1933 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location96592079-97170752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96593214 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1963 (S1963P)
Ref Sequence ENSEMBL: ENSMUSP00000056040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056102]
Predicted Effect probably benign
Transcript: ENSMUST00000056102
AA Change: S1963P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056040
Gene: ENSMUSG00000050272
AA Change: S1963P

DomainStartEndE-ValueType
IG_like 37 109 1.47e0 SMART
IG 130 218 8.33e-1 SMART
IGc2 237 300 8.7e-13 SMART
IGc2 326 392 1.24e-8 SMART
IGc2 419 491 1.1e-9 SMART
IGc2 516 582 1.99e-7 SMART
IGc2 608 676 1.84e-11 SMART
IGc2 702 773 6.01e-16 SMART
IG 794 883 1.73e-7 SMART
FN3 885 969 7.34e-9 SMART
FN3 985 1073 4.06e-11 SMART
FN3 1088 1174 7.23e-8 SMART
FN3 1189 1270 2.6e-9 SMART
IGc2 1301 1366 2.05e-9 SMART
FN3 1380 1460 7.17e-12 SMART
FN3 1477 1557 4.35e1 SMART
transmembrane domain 1595 1617 N/A INTRINSIC
low complexity region 1799 1809 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype Strain: 4830358; 3840666;5305025;3761008
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily of cell adhesion molecules (Ig-CAMs), and is involved in human central and peripheral nervous system development. This gene is a candidate for Down syndrome and congenital heart disease (DSCHD). A gene encoding a similar Ig-CAM protein is located on chromosome 11. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit background-sensitive perinatal lethality associated with respiratory distress, altered C4 ventral root and pre-inspiratory neuron signaling, and abnormal response to hypercapnia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(6) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adra2a T A 19: 54,046,406 F64L probably damaging Het
Ankrd45 A T 1: 161,151,300 N103I probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Bsn A G 9: 108,116,444 V703A possibly damaging Het
Btaf1 T A 19: 36,972,957 I529K probably damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Ccdc78 T A 17: 25,787,070 S71T probably damaging Het
Cct5 G T 15: 31,591,008 Q516K probably benign Het
Cd300c2 A T 11: 115,000,859 V63E probably benign Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Clec16a T C 16: 10,688,539 F710L probably damaging Het
Clpb T G 7: 101,779,211 F393V probably damaging Het
Commd9 G A 2: 101,901,031 R187H probably damaging Het
Crx T A 7: 15,868,376 K126* probably null Het
Dcaf13 T A 15: 39,138,088 Y264N probably damaging Het
Dnah12 T A 14: 26,734,495 I791N probably damaging Het
Dpy19l1 A T 9: 24,434,387 D456E probably damaging Het
Efl1 C T 7: 82,763,117 Q905* probably null Het
Fam57b T A 7: 126,827,672 probably null Het
Farsa T C 8: 84,861,151 F104L probably benign Het
Fbxl19 C A 7: 127,750,929 A231E probably benign Het
Fbxw19 A T 9: 109,481,650 N401K probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Frem3 A G 8: 80,612,890 N604S probably benign Het
Gad1 T G 2: 70,587,392 C312G possibly damaging Het
Garem2 G T 5: 30,114,862 E441* probably null Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm8206 A T 14: 6,022,475 M8K probably benign Het
Gpr162 G A 6: 124,861,447 S80F probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Il21 C T 3: 37,232,486 R27H probably benign Het
Il21r C T 7: 125,628,981 T208I possibly damaging Het
Kcnab2 T C 4: 152,435,866 T6A possibly damaging Het
Klra4 T A 6: 130,065,244 Q20L possibly damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Lrrtm3 A G 10: 64,088,513 F292L possibly damaging Het
Mpeg1 A T 19: 12,462,647 K490* probably null Het
Myh14 C T 7: 44,615,348 M1671I probably benign Het
Nebl A T 2: 17,375,292 M757K probably damaging Het
Olfr1110 T A 2: 87,135,844 H159L probably damaging Het
Olfr504 A C 7: 108,565,523 F91V possibly damaging Het
Olfr631 G T 7: 103,929,130 M102I probably damaging Het
Pkhd1l1 A T 15: 44,540,884 H2303L possibly damaging Het
Podxl2 C T 6: 88,849,605 V240M probably benign Het
Ppp2r5e C G 12: 75,469,567 A239P probably damaging Het
Prss53 T C 7: 127,886,262 *553W probably null Het
Psma3 T A 12: 70,984,694 M43K probably benign Het
Rad50 G T 11: 53,680,061 T790K probably benign Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Scn10a T A 9: 119,609,998 M1601L probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Serpinb5 A G 1: 106,876,121 E8G probably damaging Het
Sgcg C T 14: 61,232,412 V167I possibly damaging Het
Slc25a13 C T 6: 6,109,262 V367M probably damaging Het
Spata31 T C 13: 64,920,610 S191P probably benign Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Srgap1 G T 10: 121,925,903 D113E possibly damaging Het
Srl A G 16: 4,492,350 I505T probably damaging Het
St14 G A 9: 31,106,212 T226I probably benign Het
Stard9 T A 2: 120,698,656 I1798N possibly damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Susd1 A T 4: 59,351,695 N455K possibly damaging Het
Sytl3 T A 17: 6,733,046 V205E probably damaging Het
Tenm4 A G 7: 96,895,326 Y2183C probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tlr1 T G 5: 64,925,438 T599P possibly damaging Het
Trpc6 G A 9: 8,656,545 D658N probably damaging Het
Ttc39b A G 4: 83,232,720 V546A possibly damaging Het
Ube3c T C 5: 29,619,659 Y561H probably damaging Het
Vmn1r29 T A 6: 58,307,420 S42T probably benign Het
Vps4a T C 8: 107,044,558 V392A probably benign Het
Wdfy4 T C 14: 33,133,344 E771G probably benign Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Wnt5a C T 14: 28,511,845 P10L probably benign Het
Zfhx2 T C 14: 55,075,238 probably benign Het
Zfp451 T C 1: 33,777,822 K132R probably damaging Het
Other mutations in Dscam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dscam APN 16 96608065 missense possibly damaging 0.64
IGL00841:Dscam APN 16 96819877 missense probably damaging 1.00
IGL01289:Dscam APN 16 96643882 nonsense probably null
IGL01358:Dscam APN 16 96610343 missense possibly damaging 0.68
IGL01431:Dscam APN 16 96652078 critical splice donor site probably null
IGL01444:Dscam APN 16 96673709 missense possibly damaging 0.95
IGL01767:Dscam APN 16 96654936 missense probably damaging 1.00
IGL01866:Dscam APN 16 96685350 missense probably benign 0.06
IGL02020:Dscam APN 16 96716069 missense probably damaging 1.00
IGL02023:Dscam APN 16 96801197 missense probably benign 0.06
IGL02057:Dscam APN 16 96716073 nonsense probably null
IGL02389:Dscam APN 16 96640897 missense probably benign 0.27
IGL02409:Dscam APN 16 96819888 missense possibly damaging 0.46
IGL02694:Dscam APN 16 96593276 missense probably benign 0.00
IGL02899:Dscam APN 16 96709247 missense probably damaging 0.98
IGL02956:Dscam APN 16 96801272 missense probably damaging 0.98
IGL03035:Dscam APN 16 96819970 missense possibly damaging 0.94
IGL03191:Dscam APN 16 96820769 missense probably benign 0.36
F6893:Dscam UTSW 16 97056460 missense possibly damaging 0.78
K3955:Dscam UTSW 16 96673687 missense probably benign 0.00
R0024:Dscam UTSW 16 96593385 nonsense probably null
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0057:Dscam UTSW 16 96673736 missense probably damaging 1.00
R0117:Dscam UTSW 16 96673678 missense probably benign 0.33
R0211:Dscam UTSW 16 96716079 missense possibly damaging 0.50
R0280:Dscam UTSW 16 97039006 missense possibly damaging 0.62
R0355:Dscam UTSW 16 96654905 missense probably benign 0.00
R0380:Dscam UTSW 16 97056610 missense probably damaging 1.00
R0445:Dscam UTSW 16 96772503 missense probably damaging 1.00
R0492:Dscam UTSW 16 96825782 splice site probably null
R0534:Dscam UTSW 16 96652172 missense possibly damaging 0.67
R0593:Dscam UTSW 16 96772408 missense probably benign 0.19
R0707:Dscam UTSW 16 96825782 splice site probably null
R0738:Dscam UTSW 16 96819781 missense possibly damaging 0.48
R1017:Dscam UTSW 16 96833433 missense probably damaging 1.00
R1377:Dscam UTSW 16 96772494 missense probably damaging 1.00
R1440:Dscam UTSW 16 96819951 missense probably damaging 1.00
R1442:Dscam UTSW 16 96608074 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1464:Dscam UTSW 16 96801253 missense possibly damaging 0.94
R1478:Dscam UTSW 16 96790910 missense probably benign 0.15
R1530:Dscam UTSW 16 96819874 missense probably damaging 1.00
R1731:Dscam UTSW 16 96819876 missense probably damaging 1.00
R1765:Dscam UTSW 16 96685379 missense probably benign 0.00
R1824:Dscam UTSW 16 96825581 missense probably benign 0.00
R2005:Dscam UTSW 16 97038920 missense probably benign 0.02
R2006:Dscam UTSW 16 96819912 missense probably damaging 1.00
R2101:Dscam UTSW 16 96610349 missense probably benign 0.00
R2177:Dscam UTSW 16 96610324 missense probably damaging 0.98
R2342:Dscam UTSW 16 96619502 missense probably damaging 1.00
R2851:Dscam UTSW 16 96622715 missense possibly damaging 0.94
R2929:Dscam UTSW 16 96685412 missense possibly damaging 0.76
R3055:Dscam UTSW 16 96801355 missense probably damaging 1.00
R3157:Dscam UTSW 16 96678510 missense probably benign 0.16
R3159:Dscam UTSW 16 96678510 missense probably benign 0.16
R3944:Dscam UTSW 16 96820997 missense probably damaging 0.99
R4080:Dscam UTSW 16 96683772 missense probably benign 0.01
R4285:Dscam UTSW 16 96709109 critical splice donor site probably null
R4384:Dscam UTSW 16 96709216 missense probably damaging 0.99
R4460:Dscam UTSW 16 96610319 missense probably damaging 1.00
R4575:Dscam UTSW 16 96825623 missense possibly damaging 0.82
R4594:Dscam UTSW 16 96717996 missense possibly damaging 0.78
R4643:Dscam UTSW 16 96685301 missense probably damaging 0.96
R4698:Dscam UTSW 16 96610324 missense probably damaging 1.00
R4716:Dscam UTSW 16 96619571 missense possibly damaging 0.80
R4743:Dscam UTSW 16 96830056 missense probably benign 0.00
R4766:Dscam UTSW 16 96643988 missense probably benign 0.02
R4899:Dscam UTSW 16 96683818 missense probably benign 0.01
R4987:Dscam UTSW 16 96697521 missense probably benign 0.00
R4990:Dscam UTSW 16 96825515 missense probably benign 0.12
R5123:Dscam UTSW 16 96772437 missense probably damaging 1.00
R5130:Dscam UTSW 16 96819779 missense probably benign 0.00
R5328:Dscam UTSW 16 96673678 missense probably benign 0.33
R5666:Dscam UTSW 16 96718164 missense probably benign 0.23
R5670:Dscam UTSW 16 96718164 missense probably benign 0.23
R5678:Dscam UTSW 16 96790900 missense probably benign 0.16
R5827:Dscam UTSW 16 96649991 critical splice donor site probably null
R5907:Dscam UTSW 16 96820920 missense probably damaging 0.97
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6032:Dscam UTSW 16 96649991 critical splice donor site probably null
R6103:Dscam UTSW 16 96825581 missense probably benign
R6240:Dscam UTSW 16 96619502 missense probably damaging 1.00
R6257:Dscam UTSW 16 96673714 missense possibly damaging 0.94
R6361:Dscam UTSW 16 96622811 missense probably benign 0.08
R6405:Dscam UTSW 16 96678425 missense probably damaging 1.00
R6444:Dscam UTSW 16 96619644 missense probably damaging 1.00
R6560:Dscam UTSW 16 96825735 missense probably benign 0.00
R6598:Dscam UTSW 16 96819784 missense probably damaging 1.00
R6622:Dscam UTSW 16 96645073 missense probably benign 0.06
R6792:Dscam UTSW 16 96593255 missense probably damaging 0.96
R6792:Dscam UTSW 16 96648237 missense probably damaging 1.00
R6827:Dscam UTSW 16 97038991 missense probably damaging 1.00
R6868:Dscam UTSW 16 96829940 missense probably damaging 1.00
R6898:Dscam UTSW 16 96829900 missense probably benign 0.02
R6903:Dscam UTSW 16 96820788 missense probably damaging 1.00
R7051:Dscam UTSW 16 96819786 missense probably benign 0.01
R7146:Dscam UTSW 16 96829917 nonsense probably null
R7180:Dscam UTSW 16 96825564 missense probably damaging 0.97
R7209:Dscam UTSW 16 96650344 intron probably null
R7247:Dscam UTSW 16 96820808 missense probably damaging 0.99
R7269:Dscam UTSW 16 96678401 missense probably benign 0.00
R7301:Dscam UTSW 16 97056532 missense probably benign 0.01
R7328:Dscam UTSW 16 96645035 nonsense probably null
R7368:Dscam UTSW 16 96643931 missense probably benign 0.00
R7425:Dscam UTSW 16 96629398 missense probably damaging 1.00
R7474:Dscam UTSW 16 96819889 missense possibly damaging 0.88
R7536:Dscam UTSW 16 96641026 intron probably null
R7624:Dscam UTSW 16 96610324 missense probably damaging 1.00
R7766:Dscam UTSW 16 96790901 missense probably benign 0.31
R7817:Dscam UTSW 16 96640864 missense probably benign
X0025:Dscam UTSW 16 96709161 missense probably damaging 1.00
Z1088:Dscam UTSW 16 96772561 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGGTAGCTTTGATTGGCTCG -3'
(R):5'- GCCTCCATACCTACGAATGGAC -3'

Sequencing Primer
(F):5'- TACAACCGCTGTCCATCAGGTG -3'
(R):5'- CGAATGGACTTCTTGTTAAACCGG -3'
Posted On2014-07-14