Mutagenetix > Incidental Mutation

Incidental Mutation 'R1934:Acacb'

215657

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

039952-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1934 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114198282 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 686 (A686T)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably benign
Transcript: ENSMUST00000031583
AA Change: A686T

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: A686T

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102582
AA Change: A686T

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: A686T

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,649,833	L548P	probably damaging	Het
Abca6	A	G	11: 110,210,083		probably null	Het
Abcb5	A	G	12: 118,907,500		probably null	Het
Acot6	T	C	12: 84,106,593	V203A	probably benign	Het
Adam25	A	T	8: 40,754,885	Y396F	probably benign	Het
Adamts9	A	G	6: 92,943,121	L12P	possibly damaging	Het
Adamtsl2	A	T	2: 27,089,593	D258V	probably damaging	Het
Aox4	G	A	1: 58,245,936	V616I	probably benign	Het
Ap1m1	A	G	8: 72,255,793	I382V	probably damaging	Het
Arhgef2	G	A	3: 88,629,791	R8Q	probably damaging	Het
Arhgef37	T	G	18: 61,523,943	E17A	probably benign	Het
Arhgef7	C	A	8: 11,808,713		probably null	Het
Arih1	T	C	9: 59,394,932	D431G	probably damaging	Het
Astn2	C	T	4: 65,435,189	V1115M	probably damaging	Het
Atg7	T	A	6: 114,701,235	M280K	probably damaging	Het
Birc3	T	C	9: 7,854,499	T397A	possibly damaging	Het
Ccdc110	A	G	8: 45,943,250	N726S	probably damaging	Het
Cdadc1	A	T	14: 59,589,860	S121T	possibly damaging	Het
Cdh16	A	G	8: 104,617,963	V7A	possibly damaging	Het
Cenpb	A	G	2: 131,179,264	S205P	probably benign	Het
Chsy1	T	C	7: 66,172,243	V742A	probably damaging	Het
Col12a1	G	A	9: 79,604,522	R133*	probably null	Het
Col18a1	A	C	10: 77,112,744	S311R	possibly damaging	Het
Col9a3	G	A	2: 180,607,134	V260M	probably damaging	Het
Coq2	T	A	5: 100,661,865	R17S	probably damaging	Het
Ctf1	A	G	7: 127,712,764	R4G	probably damaging	Het
Cwc27	T	C	13: 104,631,676	D437G	probably benign	Het
Cyp4f14	T	C	17: 32,906,315	N430D	probably damaging	Het
Dars2	A	G	1: 161,063,241		probably null	Het
Dgkz	A	T	2: 91,937,104	M848K	possibly damaging	Het
Dnhd1	T	G	7: 105,708,582	V3208G	probably benign	Het
Dsg1b	A	G	18: 20,395,906	Y233C	probably damaging	Het
Edem3	A	T	1: 151,804,283	D460V	probably damaging	Het
Ednra	A	G	8: 77,689,118	S167P	possibly damaging	Het
Eif3m	A	T	2: 105,001,279	V180D	probably damaging	Het
Fam217a	T	A	13: 34,910,881	R207S	probably damaging	Het
Fcgbp	G	A	7: 28,107,093	G2162D	probably damaging	Het
Fhod3	A	T	18: 25,090,278	I894F	probably benign	Het
Fpgs	A	T	2: 32,687,981	I143N	probably damaging	Het
Fpr-rs6	A	G	17: 20,182,890	S70P	probably benign	Het
Frs2	T	C	10: 117,078,901	M38V	probably damaging	Het
Fsip2	A	G	2: 82,980,558	N2407S	possibly damaging	Het
Gabrg2	T	A	11: 41,920,470	T283S	probably benign	Het
Gas2l1	T	A	11: 5,061,408	T474S	probably benign	Het
Gli1	A	T	10: 127,331,239	M715K	possibly damaging	Het
Glra3	G	T	8: 55,940,907	A18S	probably benign	Het
Gm5800	T	A	14: 51,711,939	N183I	possibly damaging	Het
Gm8674	T	A	13: 49,901,435		noncoding transcript	Het
Gnat3	A	T	5: 18,019,510	I303F	possibly damaging	Het
Grin2d	C	T	7: 45,856,827	V547M	probably damaging	Het
Grpr	C	A	X: 163,549,141	V53L	probably benign	Het
Heatr5b	T	C	17: 78,795,918	I1169V	possibly damaging	Het
Icam5	A	G	9: 21,034,786	T305A	probably benign	Het
Itga11	T	A	9: 62,744,514	N309K	probably damaging	Het
Itgb6	T	C	2: 60,669,149	D100G	probably benign	Het
Kdm3b	A	G	18: 34,813,544	K862R	probably benign	Het
Kif7	T	C	7: 79,711,538	D135G	probably benign	Het
Lrp4	A	G	2: 91,480,432	D606G	probably damaging	Het
Lrrtm1	A	T	6: 77,244,966		probably null	Het
Metap1d	A	T	2: 71,522,583	H252L	possibly damaging	Het
Mfhas1	A	G	8: 35,591,097	K909E	possibly damaging	Het
Mrgprh	C	T	17: 12,876,951	T26I	probably damaging	Het
Myo15b	T	C	11: 115,863,484	S937P	probably benign	Het
Neto2	A	T	8: 85,670,404	I73N	possibly damaging	Het
Nod2	T	C	8: 88,663,719	I196T	probably benign	Het
Nvl	T	G	1: 181,099,128	T788P	probably damaging	Het
Olfr539	C	A	7: 140,668,038	C243*	probably null	Het
Olfr90	A	T	17: 37,086,014	D50E	possibly damaging	Het
Pax3	G	A	1: 78,103,480	T423I	possibly damaging	Het
Pde4dip	A	G	3: 97,692,691	V2403A	possibly damaging	Het
Phip	C	T	9: 82,903,182	V827I	probably benign	Het
Plcb3	A	G	19: 6,964,609	F285L	probably damaging	Het
Pnp2	A	G	14: 50,956,218	I16V	probably benign	Het
Pola2	A	G	19: 5,953,741	L202P	probably damaging	Het
Ppfia1	A	T	7: 144,505,110	N651K	probably benign	Het
Prss53	T	C	7: 127,886,748		probably null	Het
Rasgrf1	G	T	9: 89,953,913	Q231H	probably damaging	Het
Rasgrf2	A	T	13: 91,983,706		probably null	Het
Rccd1	T	A	7: 80,320,524	N115I	possibly damaging	Het
Rpgrip1	A	T	14: 52,114,644	T26S	possibly damaging	Het
Rpn1	T	A	6: 88,093,859	V237E	probably damaging	Het
Sema4f	G	T	6: 82,930,927	P180Q	probably damaging	Het
Slc36a4	T	C	9: 15,720,789	V87A	probably damaging	Het
Slc5a4b	A	T	10: 76,081,473	V243E	possibly damaging	Het
Sos2	T	G	12: 69,648,541	I141L	probably damaging	Het
Srbd1	A	G	17: 86,102,893	V537A	probably damaging	Het
Sugp1	A	G	8: 70,056,575	E166G	possibly damaging	Het
Tktl2	G	A	8: 66,512,347	V186M	probably damaging	Het
Tshr	T	C	12: 91,537,181	S298P	probably damaging	Het
Tspan14	T	C	14: 40,934,252	Y6C	probably damaging	Het
Ttn	A	T	2: 76,747,040	V24503E	probably damaging	Het
Vcan	T	A	13: 89,702,926	N1305I	probably damaging	Het
Vmn2r81	A	G	10: 79,247,794	M1V	probably null	Het
Vps39	A	T	2: 120,318,077	V873E	probably damaging	Het
Vstm2a	A	T	11: 16,409,734	D270V	unknown	Het
Wdr24	A	T	17: 25,824,266	M21L	possibly damaging	Het
Wee1	A	G	7: 110,122,491	T48A	probably benign	Het
Zfp369	T	C	13: 65,297,151	C703R	probably damaging	Het
Zfp532	A	T	18: 65,685,611	D1114V	probably damaging	Het
Zfp758	A	G	17: 22,373,652	T46A	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAAATGTCCAGTCTGTGAGTGC -3'
(R):5'- AGTCTGGGGTCAAACTCAGG -3'

Sequencing Primer
(F):5'- GATCGAACACAGGTCCTTCTG -3'
(R):5'- GGTCAAACTCAGGTATTCAGGCC -3'

Posted On

2014-07-14