Incidental Mutation 'R1934:Nod2'
ID215692
Institutional Source Beutler Lab
Gene Symbol Nod2
Ensembl Gene ENSMUSG00000055994
Gene Namenucleotide-binding oligomerization domain containing 2
SynonymsNlrc2, Card15, F830032C23Rik
MMRRC Submission 039952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R1934 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location88647315-88688474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88663719 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 196 (I196T)
Ref Sequence ENSEMBL: ENSMUSP00000113773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054324] [ENSMUST00000109634] [ENSMUST00000118370]
Predicted Effect probably benign
Transcript: ENSMUST00000054324
AA Change: I218T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050538
Gene: ENSMUSG00000055994
AA Change: I218T

DomainStartEndE-ValueType
Pfam:CARD 4 92 5.3e-20 PFAM
Blast:CARD 100 177 8e-11 BLAST
Pfam:NACHT 288 458 1.8e-46 PFAM
low complexity region 521 554 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
LRR 781 811 3.15e1 SMART
LRR 813 836 1.12e2 SMART
LRR 837 864 8.53e0 SMART
LRR 865 892 1.58e-3 SMART
LRR 893 920 4.83e-1 SMART
LRR 921 948 1.13e0 SMART
LRR 949 976 4.68e-6 SMART
LRR 977 1004 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109634
AA Change: I203T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105262
Gene: ENSMUSG00000055994
AA Change: I203T

DomainStartEndE-ValueType
Pfam:CARD 11 99 2.5e-22 PFAM
Pfam:CARD 111 195 2.1e-14 PFAM
Pfam:NACHT 273 443 1.2e-45 PFAM
low complexity region 506 539 N/A INTRINSIC
low complexity region 613 624 N/A INTRINSIC
LRR 766 796 3.15e1 SMART
LRR 798 821 1.12e2 SMART
LRR 822 849 8.53e0 SMART
LRR 850 877 1.58e-3 SMART
LRR 878 905 4.83e-1 SMART
LRR 906 933 1.13e0 SMART
LRR 934 961 4.68e-6 SMART
LRR 962 989 7.78e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118370
AA Change: I196T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113773
Gene: ENSMUSG00000055994
AA Change: I196T

DomainStartEndE-ValueType
Pfam:CARD 4 92 1e-21 PFAM
Pfam:CARD 104 188 8.4e-14 PFAM
Pfam:NACHT 266 436 2.5e-45 PFAM
low complexity region 499 532 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
LRR 759 789 3.15e1 SMART
LRR 791 814 1.12e2 SMART
LRR 815 842 8.53e0 SMART
LRR 843 870 1.58e-3 SMART
LRR 871 898 4.83e-1 SMART
LRR 899 926 1.13e0 SMART
LRR 927 954 4.68e-6 SMART
LRR 955 982 7.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124091
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal immune system morphology and physiology and increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,649,833 L548P probably damaging Het
Abca6 A G 11: 110,210,083 probably null Het
Abcb5 A G 12: 118,907,500 probably null Het
Acacb G A 5: 114,198,282 A686T probably benign Het
Acot6 T C 12: 84,106,593 V203A probably benign Het
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adamts9 A G 6: 92,943,121 L12P possibly damaging Het
Adamtsl2 A T 2: 27,089,593 D258V probably damaging Het
Aox4 G A 1: 58,245,936 V616I probably benign Het
Ap1m1 A G 8: 72,255,793 I382V probably damaging Het
Arhgef2 G A 3: 88,629,791 R8Q probably damaging Het
Arhgef37 T G 18: 61,523,943 E17A probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arih1 T C 9: 59,394,932 D431G probably damaging Het
Astn2 C T 4: 65,435,189 V1115M probably damaging Het
Atg7 T A 6: 114,701,235 M280K probably damaging Het
Birc3 T C 9: 7,854,499 T397A possibly damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Cdadc1 A T 14: 59,589,860 S121T possibly damaging Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Cenpb A G 2: 131,179,264 S205P probably benign Het
Chsy1 T C 7: 66,172,243 V742A probably damaging Het
Col12a1 G A 9: 79,604,522 R133* probably null Het
Col18a1 A C 10: 77,112,744 S311R possibly damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Coq2 T A 5: 100,661,865 R17S probably damaging Het
Ctf1 A G 7: 127,712,764 R4G probably damaging Het
Cwc27 T C 13: 104,631,676 D437G probably benign Het
Cyp4f14 T C 17: 32,906,315 N430D probably damaging Het
Dars2 A G 1: 161,063,241 probably null Het
Dgkz A T 2: 91,937,104 M848K possibly damaging Het
Dnhd1 T G 7: 105,708,582 V3208G probably benign Het
Dsg1b A G 18: 20,395,906 Y233C probably damaging Het
Edem3 A T 1: 151,804,283 D460V probably damaging Het
Ednra A G 8: 77,689,118 S167P possibly damaging Het
Eif3m A T 2: 105,001,279 V180D probably damaging Het
Fam217a T A 13: 34,910,881 R207S probably damaging Het
Fcgbp G A 7: 28,107,093 G2162D probably damaging Het
Fhod3 A T 18: 25,090,278 I894F probably benign Het
Fpgs A T 2: 32,687,981 I143N probably damaging Het
Fpr-rs6 A G 17: 20,182,890 S70P probably benign Het
Frs2 T C 10: 117,078,901 M38V probably damaging Het
Fsip2 A G 2: 82,980,558 N2407S possibly damaging Het
Gabrg2 T A 11: 41,920,470 T283S probably benign Het
Gas2l1 T A 11: 5,061,408 T474S probably benign Het
Gli1 A T 10: 127,331,239 M715K possibly damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5800 T A 14: 51,711,939 N183I possibly damaging Het
Gm8674 T A 13: 49,901,435 noncoding transcript Het
Gnat3 A T 5: 18,019,510 I303F possibly damaging Het
Grin2d C T 7: 45,856,827 V547M probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Heatr5b T C 17: 78,795,918 I1169V possibly damaging Het
Icam5 A G 9: 21,034,786 T305A probably benign Het
Itga11 T A 9: 62,744,514 N309K probably damaging Het
Itgb6 T C 2: 60,669,149 D100G probably benign Het
Kdm3b A G 18: 34,813,544 K862R probably benign Het
Kif7 T C 7: 79,711,538 D135G probably benign Het
Lrp4 A G 2: 91,480,432 D606G probably damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Metap1d A T 2: 71,522,583 H252L possibly damaging Het
Mfhas1 A G 8: 35,591,097 K909E possibly damaging Het
Mrgprh C T 17: 12,876,951 T26I probably damaging Het
Myo15b T C 11: 115,863,484 S937P probably benign Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nvl T G 1: 181,099,128 T788P probably damaging Het
Olfr539 C A 7: 140,668,038 C243* probably null Het
Olfr90 A T 17: 37,086,014 D50E possibly damaging Het
Pax3 G A 1: 78,103,480 T423I possibly damaging Het
Pde4dip A G 3: 97,692,691 V2403A possibly damaging Het
Phip C T 9: 82,903,182 V827I probably benign Het
Plcb3 A G 19: 6,964,609 F285L probably damaging Het
Pnp2 A G 14: 50,956,218 I16V probably benign Het
Pola2 A G 19: 5,953,741 L202P probably damaging Het
Ppfia1 A T 7: 144,505,110 N651K probably benign Het
Prss53 T C 7: 127,886,748 probably null Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rasgrf2 A T 13: 91,983,706 probably null Het
Rccd1 T A 7: 80,320,524 N115I possibly damaging Het
Rpgrip1 A T 14: 52,114,644 T26S possibly damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Slc36a4 T C 9: 15,720,789 V87A probably damaging Het
Slc5a4b A T 10: 76,081,473 V243E possibly damaging Het
Sos2 T G 12: 69,648,541 I141L probably damaging Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tshr T C 12: 91,537,181 S298P probably damaging Het
Tspan14 T C 14: 40,934,252 Y6C probably damaging Het
Ttn A T 2: 76,747,040 V24503E probably damaging Het
Vcan T A 13: 89,702,926 N1305I probably damaging Het
Vmn2r81 A G 10: 79,247,794 M1V probably null Het
Vps39 A T 2: 120,318,077 V873E probably damaging Het
Vstm2a A T 11: 16,409,734 D270V unknown Het
Wdr24 A T 17: 25,824,266 M21L possibly damaging Het
Wee1 A G 7: 110,122,491 T48A probably benign Het
Zfp369 T C 13: 65,297,151 C703R probably damaging Het
Zfp532 A T 18: 65,685,611 D1114V probably damaging Het
Zfp758 A G 17: 22,373,652 T46A probably damaging Het
Other mutations in Nod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Nod2 APN 8 88663736 missense probably benign 0.02
IGL02299:Nod2 APN 8 88663742 missense possibly damaging 0.81
PIT4687001:Nod2 UTSW 8 88681646 missense probably damaging 1.00
R0305:Nod2 UTSW 8 88665323 missense probably damaging 1.00
R0391:Nod2 UTSW 8 88663778 missense probably benign 0.00
R0580:Nod2 UTSW 8 88664406 missense probably damaging 1.00
R0617:Nod2 UTSW 8 88653231 missense probably benign 0.00
R0815:Nod2 UTSW 8 88672662 splice site probably benign
R1460:Nod2 UTSW 8 88663812 missense probably damaging 1.00
R1528:Nod2 UTSW 8 88664589 missense possibly damaging 0.92
R1707:Nod2 UTSW 8 88670476 missense possibly damaging 0.59
R1956:Nod2 UTSW 8 88664208 missense probably damaging 1.00
R1972:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R1973:Nod2 UTSW 8 88652873 missense probably damaging 1.00
R2902:Nod2 UTSW 8 88675463 missense probably damaging 1.00
R2918:Nod2 UTSW 8 88652891 missense probably benign 0.02
R3435:Nod2 UTSW 8 88664009 missense possibly damaging 0.64
R3705:Nod2 UTSW 8 88653320 missense probably benign 0.02
R4395:Nod2 UTSW 8 88664391 missense probably damaging 1.00
R4612:Nod2 UTSW 8 88665036 missense possibly damaging 0.65
R4756:Nod2 UTSW 8 88664274 missense possibly damaging 0.59
R5122:Nod2 UTSW 8 88664120 missense probably damaging 1.00
R5144:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R5166:Nod2 UTSW 8 88664247 missense possibly damaging 0.58
R5203:Nod2 UTSW 8 88664451 missense probably damaging 1.00
R5338:Nod2 UTSW 8 88672785 intron probably null
R5614:Nod2 UTSW 8 88664196 missense probably damaging 1.00
R5746:Nod2 UTSW 8 88664342 missense probably damaging 0.98
R5834:Nod2 UTSW 8 88664639 missense possibly damaging 0.91
R6059:Nod2 UTSW 8 88664414 missense probably damaging 1.00
R6282:Nod2 UTSW 8 88670460 missense probably benign 0.02
R6707:Nod2 UTSW 8 88665189 missense probably benign
R6741:Nod2 UTSW 8 88653066 missense probably damaging 0.99
R6838:Nod2 UTSW 8 88670458 missense possibly damaging 0.63
R7008:Nod2 UTSW 8 88663657 nonsense probably null
R7182:Nod2 UTSW 8 88663832 missense probably benign 0.01
R7324:Nod2 UTSW 8 88653066 missense probably damaging 1.00
R7344:Nod2 UTSW 8 88660582 missense probably damaging 1.00
R7588:Nod2 UTSW 8 88674908 missense possibly damaging 0.80
R7625:Nod2 UTSW 8 88665278 missense probably damaging 0.98
R7915:Nod2 UTSW 8 88660797 intron probably null
Z1088:Nod2 UTSW 8 88664146 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACCAGGTTTAGGAAGCCCC -3'
(R):5'- TGGGTATCAAAGAGGTCCTCC -3'

Sequencing Primer
(F):5'- GGTCCTGTCCCCCAAACC -3'
(R):5'- GTATCAAAGAGGTCCTCCAGGCC -3'
Posted On2014-07-14