Incidental Mutation 'R0129:Lonp2'
ID 21570
Institutional Source Beutler Lab
Gene Symbol Lonp2
Ensembl Gene ENSMUSG00000047866
Gene Name lon peptidase 2, peroxisomal
Synonyms 1300002A08Rik
MMRRC Submission 038414-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.215) question?
Stock # R0129 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 87350672-87443264 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 87361518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 232 (R232C)
Ref Sequence ENSEMBL: ENSMUSP00000118737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034141] [ENSMUST00000122188] [ENSMUST00000155433]
AlphaFold Q9DBN5
Predicted Effect probably damaging
Transcript: ENSMUST00000034141
AA Change: R232C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034141
Gene: ENSMUSG00000047866
AA Change: R232C

DomainStartEndE-ValueType
Pfam:LON_substr_bdg 12 220 1e-24 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Pfam:Lon_C 628 837 1.6e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122188
SMART Domains Protein: ENSMUSP00000113834
Gene: ENSMUSG00000047866

DomainStartEndE-ValueType
Pfam:LON 12 224 9e-17 PFAM
AAA 225 370 1.59e-10 SMART
low complexity region 396 403 N/A INTRINSIC
Pfam:Lon_C 486 695 1.5e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124911
Predicted Effect probably damaging
Transcript: ENSMUST00000155433
AA Change: R232C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118737
Gene: ENSMUSG00000047866
AA Change: R232C

DomainStartEndE-ValueType
Pfam:LON 12 220 3.3e-26 PFAM
low complexity region 243 255 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
AAA 367 512 1.59e-10 SMART
low complexity region 538 545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155501
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, peroxisomes function primarily to catalyze fatty acid beta-oxidation and, as a by-product, produce hydrogen peroxide and superoxide. The protein encoded by this gene is an ATP-dependent protease that likely plays a role in maintaining overall peroxisome homeostasis as well as proteolytically degrading peroxisomal proteins damaged by oxidation. The protein has an N-terminal Lon N substrate recognition domain, an ATPase domain, a proteolytic domain, and, in some isoforms, a C-terminal peroxisome targeting sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,920,265 (GRCm39) D31G probably damaging Het
Actr2 A G 11: 20,050,939 (GRCm39) probably benign Het
Adcy8 A G 15: 64,618,862 (GRCm39) C764R probably benign Het
Ago4 A C 4: 126,410,976 (GRCm39) F171C possibly damaging Het
Akt2 T C 7: 27,336,395 (GRCm39) F408S probably damaging Het
Ankrd24 T C 10: 81,474,163 (GRCm39) L26P probably damaging Het
Appl1 A T 14: 26,650,600 (GRCm39) M524K probably damaging Het
Arhgef11 T A 3: 87,635,370 (GRCm39) I922N probably damaging Het
Atp5pd T C 11: 115,308,744 (GRCm39) E47G probably damaging Het
Birc6 A G 17: 74,835,755 (GRCm39) D70G probably benign Het
Bola2 G A 7: 126,295,731 (GRCm39) V56M probably damaging Het
Cd300lg A G 11: 101,944,918 (GRCm39) probably null Het
Cdc42bpb A G 12: 111,271,393 (GRCm39) probably benign Het
Ceacam20 A G 7: 19,710,185 (GRCm39) N403S probably damaging Het
Cenpf T C 1: 189,391,847 (GRCm39) M662V probably benign Het
Chd3 C A 11: 69,239,327 (GRCm39) E1607* probably null Het
Chtf18 A T 17: 25,946,285 (GRCm39) Y9* probably null Het
Clta A G 4: 44,032,424 (GRCm39) N200S probably benign Het
Csmd1 G A 8: 16,129,956 (GRCm39) S1722F possibly damaging Het
Cyria C T 12: 12,412,350 (GRCm39) T204I probably damaging Het
Dennd4a T C 9: 64,800,576 (GRCm39) S905P probably damaging Het
Dhx57 T C 17: 80,546,343 (GRCm39) K1347R probably damaging Het
Dmc1 A T 15: 79,480,441 (GRCm39) probably benign Het
Dnhd1 G T 7: 105,370,131 (GRCm39) A4519S probably benign Het
Dnmbp A G 19: 43,838,466 (GRCm39) C1120R probably benign Het
Efs C T 14: 55,154,680 (GRCm39) A427T probably damaging Het
Erich6 T C 3: 58,531,799 (GRCm39) E399G probably damaging Het
Espl1 A G 15: 102,225,083 (GRCm39) T1431A probably benign Het
Fam184b A G 5: 45,690,120 (GRCm39) S830P probably damaging Het
Herc1 T A 9: 66,355,357 (GRCm39) C2203S probably damaging Het
Itpr1 G A 6: 108,326,637 (GRCm39) V120M probably damaging Het
Kcnh7 G A 2: 62,546,503 (GRCm39) T1026I probably benign Het
Kif1b A G 4: 149,345,658 (GRCm39) I394T probably benign Het
Ldlrap1 A C 4: 134,484,733 (GRCm39) V87G probably damaging Het
Lgals12 C T 19: 7,580,403 (GRCm39) V155I probably damaging Het
Limch1 A T 5: 67,116,933 (GRCm39) N116I probably damaging Het
Lrch1 C A 14: 75,073,186 (GRCm39) C151F probably benign Het
Lrig3 A G 10: 125,842,812 (GRCm39) Y579C probably damaging Het
Macf1 T C 4: 123,327,068 (GRCm39) S4808G probably damaging Het
Mapkap1 A T 2: 34,513,494 (GRCm39) K501N probably damaging Het
Mdc1 G T 17: 36,165,337 (GRCm39) R1523L probably benign Het
Mlh3 C T 12: 85,312,914 (GRCm39) probably benign Het
Mul1 T C 4: 138,165,032 (GRCm39) probably benign Het
Mybl2 G A 2: 162,901,411 (GRCm39) probably benign Het
Notch1 G C 2: 26,350,470 (GRCm39) H2223Q probably benign Het
Notch2 C A 3: 98,053,936 (GRCm39) L2200M probably benign Het
Odad3 G T 9: 21,904,848 (GRCm39) R313S probably damaging Het
Or10ak8 A T 4: 118,774,667 (GRCm39) probably null Het
Or12k5 G A 2: 36,895,057 (GRCm39) R190* probably null Het
Or5ae2 T A 7: 84,506,196 (GRCm39) F206L probably benign Het
Or8a1b T C 9: 37,623,236 (GRCm39) Y113C probably damaging Het
Plekhs1 T C 19: 56,465,722 (GRCm39) probably null Het
Ppm1h G A 10: 122,777,260 (GRCm39) G509R probably damaging Het
Ppp2r3c C T 12: 55,345,207 (GRCm39) E94K probably damaging Het
Ppp2r5e T A 12: 75,509,164 (GRCm39) I372F probably damaging Het
Ptprt G A 2: 162,119,990 (GRCm39) T159I probably benign Het
Rab20 A G 8: 11,504,415 (GRCm39) F95S probably damaging Het
Rfc3 A C 5: 151,574,616 (GRCm39) M1R probably null Het
Skp2 A G 15: 9,125,280 (GRCm39) S100P probably damaging Het
Smg5 T C 3: 88,256,540 (GRCm39) S269P probably benign Het
Sspo A T 6: 48,432,352 (GRCm39) T684S probably benign Het
Syt3 A G 7: 44,042,782 (GRCm39) K355E probably damaging Het
Tcp10a A T 17: 7,610,903 (GRCm39) K355N probably damaging Het
Tnrc18 A G 5: 142,750,800 (GRCm39) probably benign Het
Tsfm A G 10: 126,866,339 (GRCm39) L74P probably benign Het
Ttn G C 2: 76,564,609 (GRCm39) N28509K probably damaging Het
Ube2l6 G A 2: 84,629,252 (GRCm39) M1I probably null Het
Vmn2r80 T A 10: 79,005,330 (GRCm39) H322Q probably damaging Het
Zkscan8 A T 13: 21,706,441 (GRCm39) S212T probably benign Het
Other mutations in Lonp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Lonp2 APN 8 87,360,600 (GRCm39) missense probably damaging 1.00
IGL00990:Lonp2 APN 8 87,368,161 (GRCm39) splice site probably benign
IGL01654:Lonp2 APN 8 87,440,714 (GRCm39) missense probably damaging 1.00
IGL02021:Lonp2 APN 8 87,435,599 (GRCm39) missense probably benign 0.00
IGL02165:Lonp2 APN 8 87,435,654 (GRCm39) missense probably damaging 1.00
IGL02309:Lonp2 APN 8 87,361,491 (GRCm39) missense probably damaging 1.00
IGL02355:Lonp2 APN 8 87,350,874 (GRCm39) missense probably benign 0.17
IGL02362:Lonp2 APN 8 87,350,874 (GRCm39) missense probably benign 0.17
IGL02365:Lonp2 APN 8 87,442,993 (GRCm39) missense possibly damaging 0.69
IGL02374:Lonp2 APN 8 87,435,673 (GRCm39) missense probably damaging 0.97
IGL02440:Lonp2 APN 8 87,350,813 (GRCm39) start codon destroyed probably null 0.98
Furcht UTSW 8 87,358,130 (GRCm39) missense probably benign 0.09
Horror UTSW 8 87,350,876 (GRCm39) missense probably damaging 1.00
Shellshock UTSW 8 87,435,641 (GRCm39) missense probably damaging 1.00
R0083:Lonp2 UTSW 8 87,442,983 (GRCm39) missense probably benign 0.13
R0108:Lonp2 UTSW 8 87,442,983 (GRCm39) missense probably benign 0.13
R0108:Lonp2 UTSW 8 87,442,983 (GRCm39) missense probably benign 0.13
R0302:Lonp2 UTSW 8 87,364,619 (GRCm39) missense possibly damaging 0.94
R0433:Lonp2 UTSW 8 87,360,582 (GRCm39) missense probably damaging 1.00
R1148:Lonp2 UTSW 8 87,363,168 (GRCm39) missense probably benign 0.00
R1148:Lonp2 UTSW 8 87,363,168 (GRCm39) missense probably benign 0.00
R1413:Lonp2 UTSW 8 87,368,212 (GRCm39) missense probably damaging 1.00
R1589:Lonp2 UTSW 8 87,399,700 (GRCm39) splice site probably benign
R1635:Lonp2 UTSW 8 87,440,078 (GRCm39) missense possibly damaging 0.78
R1654:Lonp2 UTSW 8 87,358,078 (GRCm39) missense probably damaging 0.99
R2033:Lonp2 UTSW 8 87,435,570 (GRCm39) missense possibly damaging 0.77
R2062:Lonp2 UTSW 8 87,392,403 (GRCm39) missense probably damaging 0.99
R2065:Lonp2 UTSW 8 87,392,403 (GRCm39) missense probably damaging 0.99
R2066:Lonp2 UTSW 8 87,392,403 (GRCm39) missense probably damaging 0.99
R2068:Lonp2 UTSW 8 87,392,403 (GRCm39) missense probably damaging 0.99
R4321:Lonp2 UTSW 8 87,392,356 (GRCm39) missense probably damaging 1.00
R4713:Lonp2 UTSW 8 87,439,943 (GRCm39) missense probably damaging 0.98
R4750:Lonp2 UTSW 8 87,358,130 (GRCm39) missense probably benign 0.09
R5790:Lonp2 UTSW 8 87,358,118 (GRCm39) missense probably benign 0.24
R5854:Lonp2 UTSW 8 87,399,699 (GRCm39) critical splice donor site probably null
R5884:Lonp2 UTSW 8 87,368,254 (GRCm39) missense probably damaging 1.00
R6025:Lonp2 UTSW 8 87,440,001 (GRCm39) missense probably damaging 1.00
R6236:Lonp2 UTSW 8 87,363,215 (GRCm39) nonsense probably null
R6481:Lonp2 UTSW 8 87,361,536 (GRCm39) missense possibly damaging 0.69
R6534:Lonp2 UTSW 8 87,443,086 (GRCm39) missense probably benign 0.00
R6805:Lonp2 UTSW 8 87,435,724 (GRCm39) missense probably benign
R6983:Lonp2 UTSW 8 87,350,876 (GRCm39) missense probably damaging 1.00
R7330:Lonp2 UTSW 8 87,358,022 (GRCm39) missense probably damaging 1.00
R7641:Lonp2 UTSW 8 87,392,386 (GRCm39) missense probably benign 0.02
R7674:Lonp2 UTSW 8 87,392,386 (GRCm39) missense probably benign 0.02
R7711:Lonp2 UTSW 8 87,440,636 (GRCm39) missense probably damaging 0.99
R7826:Lonp2 UTSW 8 87,435,641 (GRCm39) missense probably damaging 1.00
R7999:Lonp2 UTSW 8 87,361,537 (GRCm39) missense probably benign 0.02
R8057:Lonp2 UTSW 8 87,440,717 (GRCm39) missense probably damaging 1.00
R8193:Lonp2 UTSW 8 87,358,091 (GRCm39) missense probably damaging 1.00
R8716:Lonp2 UTSW 8 87,442,933 (GRCm39) missense probably benign 0.20
R8766:Lonp2 UTSW 8 87,363,198 (GRCm39) missense probably benign 0.00
R8813:Lonp2 UTSW 8 87,358,073 (GRCm39) missense probably damaging 1.00
R9049:Lonp2 UTSW 8 87,435,735 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGCAGCTTAGTGACAACTTCCC -3'
(R):5'- GGCAATTAAAGGAACTGCCCCAGAC -3'

Sequencing Primer
(F):5'- TGCCACACCAAATTGATAGGG -3'
(R):5'- tggctcccatctcctacac -3'
Posted On 2013-04-11