Incidental Mutation 'R1934:Itga11'
ID215702
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
Synonyms
MMRRC Submission 039952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1934 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62744514 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 309 (N309K)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably damaging
Transcript: ENSMUST00000034774
AA Change: N309K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: N309K

DomainStartEndE-ValueType
Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159012
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,649,833 L548P probably damaging Het
Abca6 A G 11: 110,210,083 probably null Het
Abcb5 A G 12: 118,907,500 probably null Het
Acacb G A 5: 114,198,282 A686T probably benign Het
Acot6 T C 12: 84,106,593 V203A probably benign Het
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adamts9 A G 6: 92,943,121 L12P possibly damaging Het
Adamtsl2 A T 2: 27,089,593 D258V probably damaging Het
Aox4 G A 1: 58,245,936 V616I probably benign Het
Ap1m1 A G 8: 72,255,793 I382V probably damaging Het
Arhgef2 G A 3: 88,629,791 R8Q probably damaging Het
Arhgef37 T G 18: 61,523,943 E17A probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arih1 T C 9: 59,394,932 D431G probably damaging Het
Astn2 C T 4: 65,435,189 V1115M probably damaging Het
Atg7 T A 6: 114,701,235 M280K probably damaging Het
Birc3 T C 9: 7,854,499 T397A possibly damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Cdadc1 A T 14: 59,589,860 S121T possibly damaging Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Cenpb A G 2: 131,179,264 S205P probably benign Het
Chsy1 T C 7: 66,172,243 V742A probably damaging Het
Col12a1 G A 9: 79,604,522 R133* probably null Het
Col18a1 A C 10: 77,112,744 S311R possibly damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Coq2 T A 5: 100,661,865 R17S probably damaging Het
Ctf1 A G 7: 127,712,764 R4G probably damaging Het
Cwc27 T C 13: 104,631,676 D437G probably benign Het
Cyp4f14 T C 17: 32,906,315 N430D probably damaging Het
Dars2 A G 1: 161,063,241 probably null Het
Dgkz A T 2: 91,937,104 M848K possibly damaging Het
Dnhd1 T G 7: 105,708,582 V3208G probably benign Het
Dsg1b A G 18: 20,395,906 Y233C probably damaging Het
Edem3 A T 1: 151,804,283 D460V probably damaging Het
Ednra A G 8: 77,689,118 S167P possibly damaging Het
Eif3m A T 2: 105,001,279 V180D probably damaging Het
Fam217a T A 13: 34,910,881 R207S probably damaging Het
Fcgbp G A 7: 28,107,093 G2162D probably damaging Het
Fhod3 A T 18: 25,090,278 I894F probably benign Het
Fpgs A T 2: 32,687,981 I143N probably damaging Het
Fpr-rs6 A G 17: 20,182,890 S70P probably benign Het
Frs2 T C 10: 117,078,901 M38V probably damaging Het
Fsip2 A G 2: 82,980,558 N2407S possibly damaging Het
Gabrg2 T A 11: 41,920,470 T283S probably benign Het
Gas2l1 T A 11: 5,061,408 T474S probably benign Het
Gli1 A T 10: 127,331,239 M715K possibly damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5800 T A 14: 51,711,939 N183I possibly damaging Het
Gm8674 T A 13: 49,901,435 noncoding transcript Het
Gnat3 A T 5: 18,019,510 I303F possibly damaging Het
Grin2d C T 7: 45,856,827 V547M probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Heatr5b T C 17: 78,795,918 I1169V possibly damaging Het
Icam5 A G 9: 21,034,786 T305A probably benign Het
Itgb6 T C 2: 60,669,149 D100G probably benign Het
Kdm3b A G 18: 34,813,544 K862R probably benign Het
Kif7 T C 7: 79,711,538 D135G probably benign Het
Lrp4 A G 2: 91,480,432 D606G probably damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Metap1d A T 2: 71,522,583 H252L possibly damaging Het
Mfhas1 A G 8: 35,591,097 K909E possibly damaging Het
Mrgprh C T 17: 12,876,951 T26I probably damaging Het
Myo15b T C 11: 115,863,484 S937P probably benign Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nod2 T C 8: 88,663,719 I196T probably benign Het
Nvl T G 1: 181,099,128 T788P probably damaging Het
Olfr539 C A 7: 140,668,038 C243* probably null Het
Olfr90 A T 17: 37,086,014 D50E possibly damaging Het
Pax3 G A 1: 78,103,480 T423I possibly damaging Het
Pde4dip A G 3: 97,692,691 V2403A possibly damaging Het
Phip C T 9: 82,903,182 V827I probably benign Het
Plcb3 A G 19: 6,964,609 F285L probably damaging Het
Pnp2 A G 14: 50,956,218 I16V probably benign Het
Pola2 A G 19: 5,953,741 L202P probably damaging Het
Ppfia1 A T 7: 144,505,110 N651K probably benign Het
Prss53 T C 7: 127,886,748 probably null Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rasgrf2 A T 13: 91,983,706 probably null Het
Rccd1 T A 7: 80,320,524 N115I possibly damaging Het
Rpgrip1 A T 14: 52,114,644 T26S possibly damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Slc36a4 T C 9: 15,720,789 V87A probably damaging Het
Slc5a4b A T 10: 76,081,473 V243E possibly damaging Het
Sos2 T G 12: 69,648,541 I141L probably damaging Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tshr T C 12: 91,537,181 S298P probably damaging Het
Tspan14 T C 14: 40,934,252 Y6C probably damaging Het
Ttn A T 2: 76,747,040 V24503E probably damaging Het
Vcan T A 13: 89,702,926 N1305I probably damaging Het
Vmn2r81 A G 10: 79,247,794 M1V probably null Het
Vps39 A T 2: 120,318,077 V873E probably damaging Het
Vstm2a A T 11: 16,409,734 D270V unknown Het
Wdr24 A T 17: 25,824,266 M21L possibly damaging Het
Wee1 A G 7: 110,122,491 T48A probably benign Het
Zfp369 T C 13: 65,297,151 C703R probably damaging Het
Zfp532 A T 18: 65,685,611 D1114V probably damaging Het
Zfp758 A G 17: 22,373,652 T46A probably damaging Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3158:Itga11 UTSW 9 62769278 missense probably benign 0.02
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
R8263:Itga11 UTSW 9 62696980 missense possibly damaging 0.86
R8285:Itga11 UTSW 9 62752258 missense probably damaging 1.00
R8419:Itga11 UTSW 9 62755178 missense possibly damaging 0.59
R8422:Itga11 UTSW 9 62767678 missense probably benign 0.00
R8469:Itga11 UTSW 9 62771398 missense probably benign 0.00
R8475:Itga11 UTSW 9 62744045 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGTCTTATTAGTACCTCCAAAG -3'
(R):5'- GCTAAACCATTGTGCTCGGTG -3'

Sequencing Primer
(F):5'- GATATCTTTTTCAAAATGCCAGTGTC -3'
(R):5'- CTCGGTGAAATTATAGTCCTTGGAC -3'
Posted On2014-07-14