Incidental Mutation 'R1934:Abcb5'
ID215723
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 039952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R1934 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 118907500 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably null
Transcript: ENSMUST00000035515
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100982
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,649,833 L548P probably damaging Het
Abca6 A G 11: 110,210,083 probably null Het
Acacb G A 5: 114,198,282 A686T probably benign Het
Acot6 T C 12: 84,106,593 V203A probably benign Het
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adamts9 A G 6: 92,943,121 L12P possibly damaging Het
Adamtsl2 A T 2: 27,089,593 D258V probably damaging Het
Aox4 G A 1: 58,245,936 V616I probably benign Het
Ap1m1 A G 8: 72,255,793 I382V probably damaging Het
Arhgef2 G A 3: 88,629,791 R8Q probably damaging Het
Arhgef37 T G 18: 61,523,943 E17A probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arih1 T C 9: 59,394,932 D431G probably damaging Het
Astn2 C T 4: 65,435,189 V1115M probably damaging Het
Atg7 T A 6: 114,701,235 M280K probably damaging Het
Birc3 T C 9: 7,854,499 T397A possibly damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Cdadc1 A T 14: 59,589,860 S121T possibly damaging Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Cenpb A G 2: 131,179,264 S205P probably benign Het
Chsy1 T C 7: 66,172,243 V742A probably damaging Het
Col12a1 G A 9: 79,604,522 R133* probably null Het
Col18a1 A C 10: 77,112,744 S311R possibly damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Coq2 T A 5: 100,661,865 R17S probably damaging Het
Ctf1 A G 7: 127,712,764 R4G probably damaging Het
Cwc27 T C 13: 104,631,676 D437G probably benign Het
Cyp4f14 T C 17: 32,906,315 N430D probably damaging Het
Dars2 A G 1: 161,063,241 probably null Het
Dgkz A T 2: 91,937,104 M848K possibly damaging Het
Dnhd1 T G 7: 105,708,582 V3208G probably benign Het
Dsg1b A G 18: 20,395,906 Y233C probably damaging Het
Edem3 A T 1: 151,804,283 D460V probably damaging Het
Ednra A G 8: 77,689,118 S167P possibly damaging Het
Eif3m A T 2: 105,001,279 V180D probably damaging Het
Fam217a T A 13: 34,910,881 R207S probably damaging Het
Fcgbp G A 7: 28,107,093 G2162D probably damaging Het
Fhod3 A T 18: 25,090,278 I894F probably benign Het
Fpgs A T 2: 32,687,981 I143N probably damaging Het
Fpr-rs6 A G 17: 20,182,890 S70P probably benign Het
Frs2 T C 10: 117,078,901 M38V probably damaging Het
Fsip2 A G 2: 82,980,558 N2407S possibly damaging Het
Gabrg2 T A 11: 41,920,470 T283S probably benign Het
Gas2l1 T A 11: 5,061,408 T474S probably benign Het
Gli1 A T 10: 127,331,239 M715K possibly damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5800 T A 14: 51,711,939 N183I possibly damaging Het
Gm8674 T A 13: 49,901,435 noncoding transcript Het
Gnat3 A T 5: 18,019,510 I303F possibly damaging Het
Grin2d C T 7: 45,856,827 V547M probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Heatr5b T C 17: 78,795,918 I1169V possibly damaging Het
Icam5 A G 9: 21,034,786 T305A probably benign Het
Itga11 T A 9: 62,744,514 N309K probably damaging Het
Itgb6 T C 2: 60,669,149 D100G probably benign Het
Kdm3b A G 18: 34,813,544 K862R probably benign Het
Kif7 T C 7: 79,711,538 D135G probably benign Het
Lrp4 A G 2: 91,480,432 D606G probably damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Metap1d A T 2: 71,522,583 H252L possibly damaging Het
Mfhas1 A G 8: 35,591,097 K909E possibly damaging Het
Mrgprh C T 17: 12,876,951 T26I probably damaging Het
Myo15b T C 11: 115,863,484 S937P probably benign Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nod2 T C 8: 88,663,719 I196T probably benign Het
Nvl T G 1: 181,099,128 T788P probably damaging Het
Olfr539 C A 7: 140,668,038 C243* probably null Het
Olfr90 A T 17: 37,086,014 D50E possibly damaging Het
Pax3 G A 1: 78,103,480 T423I possibly damaging Het
Pde4dip A G 3: 97,692,691 V2403A possibly damaging Het
Phip C T 9: 82,903,182 V827I probably benign Het
Plcb3 A G 19: 6,964,609 F285L probably damaging Het
Pnp2 A G 14: 50,956,218 I16V probably benign Het
Pola2 A G 19: 5,953,741 L202P probably damaging Het
Ppfia1 A T 7: 144,505,110 N651K probably benign Het
Prss53 T C 7: 127,886,748 probably null Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rasgrf2 A T 13: 91,983,706 probably null Het
Rccd1 T A 7: 80,320,524 N115I possibly damaging Het
Rpgrip1 A T 14: 52,114,644 T26S possibly damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Slc36a4 T C 9: 15,720,789 V87A probably damaging Het
Slc5a4b A T 10: 76,081,473 V243E possibly damaging Het
Sos2 T G 12: 69,648,541 I141L probably damaging Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tshr T C 12: 91,537,181 S298P probably damaging Het
Tspan14 T C 14: 40,934,252 Y6C probably damaging Het
Ttn A T 2: 76,747,040 V24503E probably damaging Het
Vcan T A 13: 89,702,926 N1305I probably damaging Het
Vmn2r81 A G 10: 79,247,794 M1V probably null Het
Vps39 A T 2: 120,318,077 V873E probably damaging Het
Vstm2a A T 11: 16,409,734 D270V unknown Het
Wdr24 A T 17: 25,824,266 M21L possibly damaging Het
Wee1 A G 7: 110,122,491 T48A probably benign Het
Zfp369 T C 13: 65,297,151 C703R probably damaging Het
Zfp532 A T 18: 65,685,611 D1114V probably damaging Het
Zfp758 A G 17: 22,373,652 T46A probably damaging Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
PIT4366001:Abcb5 UTSW 12 118936098 missense probably damaging 1.00
PIT4434001:Abcb5 UTSW 12 118890687 missense probably damaging 1.00
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4606:Abcb5 UTSW 12 118932610 critical splice acceptor site probably null
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
R7021:Abcb5 UTSW 12 118931925 missense probably benign 0.00
R7061:Abcb5 UTSW 12 118877774 missense probably damaging 1.00
R7175:Abcb5 UTSW 12 118867876 missense probably benign 0.00
R7239:Abcb5 UTSW 12 118928725 missense probably benign 0.19
R7267:Abcb5 UTSW 12 118952470 missense probably damaging 1.00
R7303:Abcb5 UTSW 12 118911560 missense probably damaging 0.96
R7396:Abcb5 UTSW 12 118867874 missense probably damaging 1.00
R7605:Abcb5 UTSW 12 118918164 missense probably damaging 1.00
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Z1176:Abcb5 UTSW 12 118918272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACAGACATGGTCCATCTCCTG -3'
(R):5'- ATAGGTTCCAGTGCACTTCCG -3'

Sequencing Primer
(F):5'- GTCCATCTCCTGGGCTCAG -3'
(R):5'- CCATAATACCCTCAGACTGATGTTG -3'
Posted On2014-07-14