Incidental Mutation 'R1934:Heatr5b'
ID215744
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission 039952-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R1934 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78795918 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1169 (I1169V)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097281
AA Change: I1169V

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: I1169V

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,649,833 L548P probably damaging Het
Abca6 A G 11: 110,210,083 probably null Het
Abcb5 A G 12: 118,907,500 probably null Het
Acacb G A 5: 114,198,282 A686T probably benign Het
Acot6 T C 12: 84,106,593 V203A probably benign Het
Adam25 A T 8: 40,754,885 Y396F probably benign Het
Adamts9 A G 6: 92,943,121 L12P possibly damaging Het
Adamtsl2 A T 2: 27,089,593 D258V probably damaging Het
Aox4 G A 1: 58,245,936 V616I probably benign Het
Ap1m1 A G 8: 72,255,793 I382V probably damaging Het
Arhgef2 G A 3: 88,629,791 R8Q probably damaging Het
Arhgef37 T G 18: 61,523,943 E17A probably benign Het
Arhgef7 C A 8: 11,808,713 probably null Het
Arih1 T C 9: 59,394,932 D431G probably damaging Het
Astn2 C T 4: 65,435,189 V1115M probably damaging Het
Atg7 T A 6: 114,701,235 M280K probably damaging Het
Birc3 T C 9: 7,854,499 T397A possibly damaging Het
Ccdc110 A G 8: 45,943,250 N726S probably damaging Het
Cdadc1 A T 14: 59,589,860 S121T possibly damaging Het
Cdh16 A G 8: 104,617,963 V7A possibly damaging Het
Cenpb A G 2: 131,179,264 S205P probably benign Het
Chsy1 T C 7: 66,172,243 V742A probably damaging Het
Col12a1 G A 9: 79,604,522 R133* probably null Het
Col18a1 A C 10: 77,112,744 S311R possibly damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Coq2 T A 5: 100,661,865 R17S probably damaging Het
Ctf1 A G 7: 127,712,764 R4G probably damaging Het
Cwc27 T C 13: 104,631,676 D437G probably benign Het
Cyp4f14 T C 17: 32,906,315 N430D probably damaging Het
Dars2 A G 1: 161,063,241 probably null Het
Dgkz A T 2: 91,937,104 M848K possibly damaging Het
Dnhd1 T G 7: 105,708,582 V3208G probably benign Het
Dsg1b A G 18: 20,395,906 Y233C probably damaging Het
Edem3 A T 1: 151,804,283 D460V probably damaging Het
Ednra A G 8: 77,689,118 S167P possibly damaging Het
Eif3m A T 2: 105,001,279 V180D probably damaging Het
Fam217a T A 13: 34,910,881 R207S probably damaging Het
Fcgbp G A 7: 28,107,093 G2162D probably damaging Het
Fhod3 A T 18: 25,090,278 I894F probably benign Het
Fpgs A T 2: 32,687,981 I143N probably damaging Het
Fpr-rs6 A G 17: 20,182,890 S70P probably benign Het
Frs2 T C 10: 117,078,901 M38V probably damaging Het
Fsip2 A G 2: 82,980,558 N2407S possibly damaging Het
Gabrg2 T A 11: 41,920,470 T283S probably benign Het
Gas2l1 T A 11: 5,061,408 T474S probably benign Het
Gli1 A T 10: 127,331,239 M715K possibly damaging Het
Glra3 G T 8: 55,940,907 A18S probably benign Het
Gm5800 T A 14: 51,711,939 N183I possibly damaging Het
Gm8674 T A 13: 49,901,435 noncoding transcript Het
Gnat3 A T 5: 18,019,510 I303F possibly damaging Het
Grin2d C T 7: 45,856,827 V547M probably damaging Het
Grpr C A X: 163,549,141 V53L probably benign Het
Icam5 A G 9: 21,034,786 T305A probably benign Het
Itga11 T A 9: 62,744,514 N309K probably damaging Het
Itgb6 T C 2: 60,669,149 D100G probably benign Het
Kdm3b A G 18: 34,813,544 K862R probably benign Het
Kif7 T C 7: 79,711,538 D135G probably benign Het
Lrp4 A G 2: 91,480,432 D606G probably damaging Het
Lrrtm1 A T 6: 77,244,966 probably null Het
Metap1d A T 2: 71,522,583 H252L possibly damaging Het
Mfhas1 A G 8: 35,591,097 K909E possibly damaging Het
Mrgprh C T 17: 12,876,951 T26I probably damaging Het
Myo15b T C 11: 115,863,484 S937P probably benign Het
Neto2 A T 8: 85,670,404 I73N possibly damaging Het
Nod2 T C 8: 88,663,719 I196T probably benign Het
Nvl T G 1: 181,099,128 T788P probably damaging Het
Olfr539 C A 7: 140,668,038 C243* probably null Het
Olfr90 A T 17: 37,086,014 D50E possibly damaging Het
Pax3 G A 1: 78,103,480 T423I possibly damaging Het
Pde4dip A G 3: 97,692,691 V2403A possibly damaging Het
Phip C T 9: 82,903,182 V827I probably benign Het
Plcb3 A G 19: 6,964,609 F285L probably damaging Het
Pnp2 A G 14: 50,956,218 I16V probably benign Het
Pola2 A G 19: 5,953,741 L202P probably damaging Het
Ppfia1 A T 7: 144,505,110 N651K probably benign Het
Prss53 T C 7: 127,886,748 probably null Het
Rasgrf1 G T 9: 89,953,913 Q231H probably damaging Het
Rasgrf2 A T 13: 91,983,706 probably null Het
Rccd1 T A 7: 80,320,524 N115I possibly damaging Het
Rpgrip1 A T 14: 52,114,644 T26S possibly damaging Het
Rpn1 T A 6: 88,093,859 V237E probably damaging Het
Sema4f G T 6: 82,930,927 P180Q probably damaging Het
Slc36a4 T C 9: 15,720,789 V87A probably damaging Het
Slc5a4b A T 10: 76,081,473 V243E possibly damaging Het
Sos2 T G 12: 69,648,541 I141L probably damaging Het
Srbd1 A G 17: 86,102,893 V537A probably damaging Het
Sugp1 A G 8: 70,056,575 E166G possibly damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tshr T C 12: 91,537,181 S298P probably damaging Het
Tspan14 T C 14: 40,934,252 Y6C probably damaging Het
Ttn A T 2: 76,747,040 V24503E probably damaging Het
Vcan T A 13: 89,702,926 N1305I probably damaging Het
Vmn2r81 A G 10: 79,247,794 M1V probably null Het
Vps39 A T 2: 120,318,077 V873E probably damaging Het
Vstm2a A T 11: 16,409,734 D270V unknown Het
Wdr24 A T 17: 25,824,266 M21L possibly damaging Het
Wee1 A G 7: 110,122,491 T48A probably benign Het
Zfp369 T C 13: 65,297,151 C703R probably damaging Het
Zfp532 A T 18: 65,685,611 D1114V probably damaging Het
Zfp758 A G 17: 22,373,652 T46A probably damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6575:Heatr5b UTSW 17 78762989 missense probably damaging 1.00
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCTGTGAATGAAAGTCAACGATAC -3'
(R):5'- GCATATAACATCGCACGCG -3'

Sequencing Primer
(F):5'- TGGGCTCAATAGAGAAGTGTATCTAC -3'
(R):5'- ACGCGCACAGATTTACTTGTG -3'
Posted On2014-07-14