Incidental Mutation 'R1936:Speg'
ID 215756
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e
MMRRC Submission 039954-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1936 (G1)
Quality Score 148
Status Validated
Chromosome 1
Chromosomal Location 75351941-75408964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 75408052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 3249 (T3249I)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037796] [ENSMUST00000087122] [ENSMUST00000113584] [ENSMUST00000131545] [ENSMUST00000133418] [ENSMUST00000140287] [ENSMUST00000141124] [ENSMUST00000144874] [ENSMUST00000145166] [ENSMUST00000143730]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037796
SMART Domains Protein: ENSMUSP00000035564
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.2e-30 PFAM
Pfam:NTP_transf_3 4 206 4.1e-10 PFAM
Pfam:Hexapep 280 321 2.6e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087122
AA Change: T3249I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: T3249I

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113584
SMART Domains Protein: ENSMUSP00000109214
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 1.6e-28 PFAM
Pfam:NTP_transf_3 4 206 1.6e-9 PFAM
Pfam:Hexapep 286 321 4.3e-8 PFAM
low complexity region 357 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131545
SMART Domains Protein: ENSMUSP00000120841
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 7.2e-31 PFAM
Pfam:NTP_transf_3 4 157 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133418
SMART Domains Protein: ENSMUSP00000122443
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 209 6.8e-31 PFAM
Pfam:NTP_transf_3 4 204 1e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137868
AA Change: T2996I
Predicted Effect probably benign
Transcript: ENSMUST00000140287
SMART Domains Protein: ENSMUSP00000121552
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 161 1.7e-22 PFAM
Pfam:NTP_transf_3 4 155 6.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141124
SMART Domains Protein: ENSMUSP00000116783
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 72 1.1e-13 PFAM
Pfam:NTP_transf_3 4 71 1.9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143679
Predicted Effect probably benign
Transcript: ENSMUST00000144874
SMART Domains Protein: ENSMUSP00000121418
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 1 174 6.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145166
SMART Domains Protein: ENSMUSP00000116754
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 91 5.2e-15 PFAM
Pfam:NTP_transf_3 4 88 1.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143730
SMART Domains Protein: ENSMUSP00000114375
Gene: ENSMUSG00000033021

DomainStartEndE-ValueType
Pfam:NTP_transferase 3 196 1.1e-30 PFAM
Pfam:NTP_transf_3 4 173 9.2e-12 PFAM
Meta Mutation Damage Score 0.1890 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 99% (98/99)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,894,061 (GRCm39) Q226R possibly damaging Het
Abca13 G A 11: 9,243,595 (GRCm39) M1819I probably benign Het
Abca4 G A 3: 121,846,572 (GRCm39) V30M probably benign Het
Ablim1 T A 19: 57,204,397 (GRCm39) probably null Het
Adgrf3 A T 5: 30,407,304 (GRCm39) N207K probably benign Het
Anapc4 T A 5: 52,997,010 (GRCm39) D94E probably damaging Het
Arfgef2 A G 2: 166,705,523 (GRCm39) N918S probably benign Het
Arhgap45 A G 10: 79,866,788 (GRCm39) N1097S probably damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
AU016765 G A 17: 64,826,873 (GRCm39) noncoding transcript Het
Brd10 A G 19: 29,731,077 (GRCm39) F712S possibly damaging Het
Cacna2d2 T C 9: 107,386,455 (GRCm39) F194S probably damaging Het
Cacna2d4 A G 6: 119,247,722 (GRCm39) D341G possibly damaging Het
Cdc42bpg A G 19: 6,360,339 (GRCm39) Y175C probably damaging Het
Cep170b G T 12: 112,702,172 (GRCm39) D322Y probably damaging Het
Cflar T A 1: 58,791,784 (GRCm39) Y362* probably null Het
Chml A T 1: 175,514,825 (GRCm39) C365* probably null Het
Clrn3 A C 7: 135,115,753 (GRCm39) I199S possibly damaging Het
Crtam G C 9: 40,915,846 (GRCm39) P13A probably benign Het
Defb26 T A 2: 152,350,195 (GRCm39) K28N possibly damaging Het
Dennd1c G A 17: 57,380,889 (GRCm39) probably benign Het
Dgkz A T 2: 91,768,323 (GRCm39) M761K possibly damaging Het
Dnhd1 A T 7: 105,323,183 (GRCm39) M564L probably benign Het
Dusp15 A G 2: 152,787,341 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,139,159 (GRCm39) probably null Het
Eapp A T 12: 54,720,513 (GRCm39) M234K probably benign Het
Epha8 T C 4: 136,667,554 (GRCm39) D309G probably benign Het
Gfi1b T C 2: 28,500,125 (GRCm39) K302R possibly damaging Het
Gimap3 A T 6: 48,742,683 (GRCm39) F82L probably damaging Het
Gm4862 T C 3: 138,834,253 (GRCm39) noncoding transcript Het
Gpatch1 A G 7: 34,994,947 (GRCm39) S440P probably damaging Het
Gpr152 A G 19: 4,192,531 (GRCm39) D24G probably damaging Het
Gpr6 T C 10: 40,947,477 (GRCm39) E35G probably benign Het
Hip1r T A 5: 124,134,134 (GRCm39) M270K probably damaging Het
Hk3 C T 13: 55,159,204 (GRCm39) V451I probably damaging Het
Itprid1 G T 6: 55,874,666 (GRCm39) L205F probably damaging Het
Jag1 C G 2: 136,925,393 (GRCm39) V1070L possibly damaging Het
Klf16 G A 10: 80,412,739 (GRCm39) A99V probably benign Het
Lama5 T C 2: 179,832,714 (GRCm39) N1646S probably benign Het
Lvrn A T 18: 47,011,387 (GRCm39) Y448F probably benign Het
Mark3 A G 12: 111,584,799 (GRCm39) M132V probably damaging Het
Mast3 A G 8: 71,237,444 (GRCm39) Y577H probably damaging Het
Med24 A T 11: 98,609,642 (GRCm39) probably null Het
Mif G T 10: 75,695,681 (GRCm39) H41N possibly damaging Het
Myo18b T C 5: 112,908,222 (GRCm39) N2017S probably benign Het
Neurl4 C T 11: 69,797,959 (GRCm39) R740C probably damaging Het
Nlgn1 G T 3: 26,385,939 (GRCm39) probably benign Het
Or10ad1c T A 15: 98,085,462 (GRCm39) H72L probably benign Het
Or2ak6 T A 11: 58,593,172 (GRCm39) L215Q probably damaging Het
Or5t15 A G 2: 86,681,745 (GRCm39) M99T probably benign Het
Or8b12i A G 9: 20,082,477 (GRCm39) L130P probably damaging Het
Paip1 T A 13: 119,593,550 (GRCm39) M463K probably damaging Het
Parp3 T A 9: 106,351,931 (GRCm39) Y147F probably damaging Het
Pgrmc2 C A 3: 41,037,473 (GRCm39) probably benign Het
Phldb3 G A 7: 24,316,832 (GRCm39) A278T probably benign Het
Plxnb1 T C 9: 108,924,715 (GRCm39) probably null Het
Pphln1 A G 15: 93,386,868 (GRCm39) D234G possibly damaging Het
Prdm2 T C 4: 142,861,032 (GRCm39) S753G probably benign Het
Prss32 A G 17: 24,075,024 (GRCm39) R125G possibly damaging Het
Psg22 A T 7: 18,453,635 (GRCm39) N149I probably damaging Het
Psmd11 T C 11: 80,319,570 (GRCm39) L20P probably damaging Het
Recql5 T C 11: 115,788,017 (GRCm39) Y434C probably benign Het
Rexo1 A G 10: 80,386,303 (GRCm39) S252P probably benign Het
Sdr9c7 A G 10: 127,739,503 (GRCm39) K206R probably benign Het
Slc17a8 T C 10: 89,413,777 (GRCm39) M484V probably benign Het
Slc1a2 A G 2: 102,607,950 (GRCm39) N530D probably benign Het
Slc25a14 G A X: 47,740,840 (GRCm39) V210I probably benign Het
Slc25a24 A T 3: 109,043,581 (GRCm39) E79D probably damaging Het
Smchd1 T C 17: 71,770,786 (GRCm39) Y132C probably damaging Het
Sorcs1 T C 19: 50,221,082 (GRCm39) D545G probably damaging Het
Sorcs2 A G 5: 36,228,731 (GRCm39) S104P possibly damaging Het
Spry4 A G 18: 38,723,142 (GRCm39) I207T possibly damaging Het
Srsf6 C T 2: 162,776,403 (GRCm39) probably benign Het
Tdrd6 A G 17: 43,937,358 (GRCm39) L1230P probably damaging Het
Tesk2 A G 4: 116,599,021 (GRCm39) Y43C probably benign Het
Tex101 A G 7: 24,367,650 (GRCm39) V234A probably benign Het
Tmem161b T A 13: 84,441,585 (GRCm39) L210Q probably damaging Het
Tmprss11f T A 5: 86,692,723 (GRCm39) Q67L probably benign Het
Tnfrsf23 A G 7: 143,222,291 (GRCm39) F174L probably benign Het
Tnrc6c A G 11: 117,646,849 (GRCm39) D1450G possibly damaging Het
Trdmt1 A G 2: 13,516,420 (GRCm39) L386P probably damaging Het
Trim25 A T 11: 88,895,576 (GRCm39) T206S probably benign Het
Trit1 T C 4: 122,948,033 (GRCm39) I451T probably benign Het
Trpc4 T A 3: 54,187,311 (GRCm39) M421K probably damaging Het
Ttc34 G A 4: 154,950,139 (GRCm39) A1031T possibly damaging Het
Ttn A C 2: 76,715,834 (GRCm39) probably benign Het
Ttn T A 2: 76,577,522 (GRCm39) D24457V probably damaging Het
Ubiad1 A G 4: 148,528,468 (GRCm39) L147P probably damaging Het
Vmn2r94 G A 17: 18,464,554 (GRCm39) R579* probably null Het
Vps72 T A 3: 95,029,851 (GRCm39) V290D probably benign Het
Wipf2 C T 11: 98,783,236 (GRCm39) R221* probably null Het
Zfp26 A G 9: 20,348,849 (GRCm39) Y572H probably benign Het
Zfp292 A G 4: 34,807,452 (GRCm39) V1864A probably benign Het
Zfp952 A T 17: 33,222,643 (GRCm39) H374L possibly damaging Het
Zfy2 C A Y: 2,121,496 (GRCm39) M132I probably benign Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75,387,034 (GRCm39) missense possibly damaging 0.95
IGL00979:Speg APN 1 75,387,378 (GRCm39) missense probably damaging 0.98
IGL01122:Speg APN 1 75,386,679 (GRCm39) missense probably damaging 1.00
IGL01293:Speg APN 1 75,364,746 (GRCm39) missense probably damaging 1.00
IGL01304:Speg APN 1 75,404,841 (GRCm39) missense probably benign 0.00
IGL01351:Speg APN 1 75,387,920 (GRCm39) splice site probably benign
IGL01473:Speg APN 1 75,404,929 (GRCm39) missense possibly damaging 0.53
IGL01477:Speg APN 1 75,368,541 (GRCm39) missense probably damaging 1.00
IGL01485:Speg APN 1 75,364,471 (GRCm39) missense probably damaging 1.00
IGL01584:Speg APN 1 75,407,581 (GRCm39) missense probably damaging 1.00
IGL01959:Speg APN 1 75,367,734 (GRCm39) missense probably damaging 1.00
IGL02231:Speg APN 1 75,400,031 (GRCm39) missense probably damaging 1.00
IGL02355:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL02362:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL03013:Speg APN 1 75,407,923 (GRCm39) missense probably damaging 0.97
IGL03168:Speg APN 1 75,364,831 (GRCm39) missense probably damaging 1.00
H8562:Speg UTSW 1 75,392,241 (GRCm39) missense probably benign 0.39
R0112:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0311:Speg UTSW 1 75,407,581 (GRCm39) missense probably damaging 1.00
R0315:Speg UTSW 1 75,391,780 (GRCm39) missense possibly damaging 0.88
R0393:Speg UTSW 1 75,400,568 (GRCm39) missense possibly damaging 0.46
R0403:Speg UTSW 1 75,407,428 (GRCm39) splice site probably benign
R0483:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0648:Speg UTSW 1 75,404,622 (GRCm39) missense probably benign
R0683:Speg UTSW 1 75,405,762 (GRCm39) missense probably damaging 1.00
R0800:Speg UTSW 1 75,400,133 (GRCm39) missense probably damaging 1.00
R0815:Speg UTSW 1 75,392,036 (GRCm39) missense probably damaging 1.00
R0835:Speg UTSW 1 75,352,318 (GRCm39) missense probably benign 0.00
R0866:Speg UTSW 1 75,393,727 (GRCm39) missense probably damaging 0.99
R0880:Speg UTSW 1 75,381,705 (GRCm39) missense probably damaging 1.00
R1082:Speg UTSW 1 75,391,782 (GRCm39) missense possibly damaging 0.94
R1140:Speg UTSW 1 75,405,739 (GRCm39) missense probably damaging 1.00
R1252:Speg UTSW 1 75,403,739 (GRCm39) missense probably damaging 1.00
R1301:Speg UTSW 1 75,378,145 (GRCm39) missense probably damaging 1.00
R1348:Speg UTSW 1 75,399,516 (GRCm39) missense probably damaging 0.99
R1388:Speg UTSW 1 75,407,104 (GRCm39) missense probably damaging 0.99
R1465:Speg UTSW 1 75,405,128 (GRCm39) splice site probably benign
R1505:Speg UTSW 1 75,352,186 (GRCm39) missense probably benign 0.02
R1506:Speg UTSW 1 75,394,307 (GRCm39) missense probably benign 0.03
R1531:Speg UTSW 1 75,377,866 (GRCm39) missense possibly damaging 0.86
R1543:Speg UTSW 1 75,398,595 (GRCm39) missense probably damaging 1.00
R1567:Speg UTSW 1 75,404,691 (GRCm39) missense probably benign
R1630:Speg UTSW 1 75,399,621 (GRCm39) missense probably damaging 1.00
R1667:Speg UTSW 1 75,387,193 (GRCm39) splice site probably benign
R1673:Speg UTSW 1 75,387,807 (GRCm39) missense possibly damaging 0.60
R1718:Speg UTSW 1 75,398,388 (GRCm39) missense possibly damaging 0.87
R1718:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1719:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1759:Speg UTSW 1 75,377,806 (GRCm39) missense possibly damaging 0.95
R1861:Speg UTSW 1 75,365,649 (GRCm39) missense probably damaging 1.00
R1874:Speg UTSW 1 75,400,550 (GRCm39) missense probably benign
R2192:Speg UTSW 1 75,394,371 (GRCm39) missense probably damaging 1.00
R2204:Speg UTSW 1 75,407,121 (GRCm39) missense probably benign 0.30
R2287:Speg UTSW 1 75,407,109 (GRCm39) missense possibly damaging 0.76
R2696:Speg UTSW 1 75,383,570 (GRCm39) missense probably benign 0.27
R2983:Speg UTSW 1 75,361,574 (GRCm39) missense possibly damaging 0.83
R3110:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3112:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3154:Speg UTSW 1 75,378,186 (GRCm39) missense probably damaging 1.00
R3720:Speg UTSW 1 75,403,426 (GRCm39) missense probably damaging 1.00
R3983:Speg UTSW 1 75,399,191 (GRCm39) missense probably benign 0.27
R4133:Speg UTSW 1 75,404,548 (GRCm39) missense probably benign
R4522:Speg UTSW 1 75,404,974 (GRCm39) missense probably damaging 1.00
R4564:Speg UTSW 1 75,368,478 (GRCm39) missense probably damaging 1.00
R4577:Speg UTSW 1 75,392,039 (GRCm39) missense probably damaging 1.00
R4858:Speg UTSW 1 75,398,379 (GRCm39) missense probably damaging 1.00
R4953:Speg UTSW 1 75,400,508 (GRCm39) missense possibly damaging 0.72
R4965:Speg UTSW 1 75,404,347 (GRCm39) missense probably damaging 1.00
R4967:Speg UTSW 1 75,364,513 (GRCm39) missense probably damaging 1.00
R5152:Speg UTSW 1 75,404,742 (GRCm39) missense possibly damaging 0.92
R5156:Speg UTSW 1 75,404,731 (GRCm39) missense probably damaging 0.99
R5371:Speg UTSW 1 75,408,037 (GRCm39) missense possibly damaging 0.50
R5550:Speg UTSW 1 75,405,744 (GRCm39) missense probably damaging 1.00
R5562:Speg UTSW 1 75,403,700 (GRCm39) missense probably damaging 1.00
R5687:Speg UTSW 1 75,395,773 (GRCm39) splice site probably null
R5985:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6004:Speg UTSW 1 75,392,247 (GRCm39) nonsense probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6143:Speg UTSW 1 75,391,031 (GRCm39) missense probably damaging 1.00
R6265:Speg UTSW 1 75,383,323 (GRCm39) nonsense probably null
R6347:Speg UTSW 1 75,403,519 (GRCm39) missense probably benign 0.00
R6453:Speg UTSW 1 75,394,616 (GRCm39) missense probably benign 0.06
R6505:Speg UTSW 1 75,406,167 (GRCm39) missense possibly damaging 0.93
R6505:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6531:Speg UTSW 1 75,399,401 (GRCm39) missense probably benign 0.03
R6566:Speg UTSW 1 75,365,107 (GRCm39) missense probably damaging 1.00
R6747:Speg UTSW 1 75,387,039 (GRCm39) critical splice donor site probably null
R6819:Speg UTSW 1 75,368,456 (GRCm39) missense possibly damaging 0.56
R6821:Speg UTSW 1 75,394,547 (GRCm39) missense possibly damaging 0.83
R6919:Speg UTSW 1 75,364,552 (GRCm39) nonsense probably null
R6981:Speg UTSW 1 75,407,557 (GRCm39) missense probably damaging 1.00
R7002:Speg UTSW 1 75,399,912 (GRCm39) missense probably damaging 0.98
R7082:Speg UTSW 1 75,388,091 (GRCm39) missense probably damaging 0.96
R7140:Speg UTSW 1 75,383,414 (GRCm39) critical splice donor site probably null
R7175:Speg UTSW 1 75,399,134 (GRCm39) missense probably benign 0.01
R7178:Speg UTSW 1 75,399,027 (GRCm39) missense possibly damaging 0.46
R7345:Speg UTSW 1 75,361,479 (GRCm39) missense probably damaging 0.97
R7420:Speg UTSW 1 75,407,549 (GRCm39) missense probably damaging 1.00
R7537:Speg UTSW 1 75,378,108 (GRCm39) missense probably damaging 1.00
R7562:Speg UTSW 1 75,407,923 (GRCm39) missense probably damaging 0.97
R7615:Speg UTSW 1 75,405,886 (GRCm39) missense probably damaging 1.00
R7679:Speg UTSW 1 75,382,959 (GRCm39) missense probably damaging 1.00
R7692:Speg UTSW 1 75,377,834 (GRCm39) missense probably benign 0.04
R7696:Speg UTSW 1 75,405,805 (GRCm39) missense probably damaging 1.00
R7719:Speg UTSW 1 75,352,469 (GRCm39) missense probably damaging 1.00
R7794:Speg UTSW 1 75,365,514 (GRCm39) missense probably benign 0.00
R7824:Speg UTSW 1 75,360,661 (GRCm39) splice site probably null
R7834:Speg UTSW 1 75,361,571 (GRCm39) missense probably damaging 1.00
R7892:Speg UTSW 1 75,403,810 (GRCm39) missense probably damaging 1.00
R8015:Speg UTSW 1 75,392,065 (GRCm39) splice site probably benign
R8068:Speg UTSW 1 75,398,894 (GRCm39) missense probably damaging 1.00
R8085:Speg UTSW 1 75,391,997 (GRCm39) missense probably damaging 1.00
R8130:Speg UTSW 1 75,392,240 (GRCm39) missense probably damaging 1.00
R8132:Speg UTSW 1 75,399,639 (GRCm39) missense probably damaging 1.00
R8239:Speg UTSW 1 75,395,677 (GRCm39) missense probably damaging 1.00
R8287:Speg UTSW 1 75,398,880 (GRCm39) missense probably benign 0.26
R8299:Speg UTSW 1 75,364,480 (GRCm39) missense possibly damaging 0.95
R8441:Speg UTSW 1 75,387,976 (GRCm39) missense possibly damaging 0.60
R8468:Speg UTSW 1 75,407,953 (GRCm39) missense probably damaging 1.00
R8555:Speg UTSW 1 75,378,908 (GRCm39) splice site probably null
R8781:Speg UTSW 1 75,383,665 (GRCm39) missense probably damaging 1.00
R8784:Speg UTSW 1 75,381,793 (GRCm39) critical splice donor site probably benign
R8848:Speg UTSW 1 75,404,082 (GRCm39) critical splice donor site probably null
R8881:Speg UTSW 1 75,377,795 (GRCm39) missense possibly damaging 0.67
R8898:Speg UTSW 1 75,365,517 (GRCm39) missense probably damaging 1.00
R8935:Speg UTSW 1 75,399,250 (GRCm39) missense probably benign 0.30
R9019:Speg UTSW 1 75,405,882 (GRCm39) missense probably damaging 1.00
R9027:Speg UTSW 1 75,365,076 (GRCm39) missense possibly damaging 0.67
R9066:Speg UTSW 1 75,361,654 (GRCm39) missense probably damaging 0.99
R9092:Speg UTSW 1 75,399,378 (GRCm39) missense probably benign 0.01
R9117:Speg UTSW 1 75,364,444 (GRCm39) missense probably damaging 1.00
R9202:Speg UTSW 1 75,367,637 (GRCm39) missense probably damaging 1.00
R9246:Speg UTSW 1 75,361,498 (GRCm39) missense probably damaging 1.00
R9248:Speg UTSW 1 75,398,420 (GRCm39) missense probably damaging 1.00
R9451:Speg UTSW 1 75,394,377 (GRCm39) missense probably damaging 1.00
R9452:Speg UTSW 1 75,399,152 (GRCm39) missense probably benign
R9475:Speg UTSW 1 75,364,735 (GRCm39) missense probably damaging 1.00
R9476:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9510:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9519:Speg UTSW 1 75,392,380 (GRCm39) missense probably damaging 1.00
R9528:Speg UTSW 1 75,364,447 (GRCm39) missense possibly damaging 0.78
R9542:Speg UTSW 1 75,399,426 (GRCm39) missense probably benign 0.08
R9553:Speg UTSW 1 75,394,645 (GRCm39) missense probably benign 0.00
R9767:Speg UTSW 1 75,403,825 (GRCm39) missense possibly damaging 0.78
R9768:Speg UTSW 1 75,395,617 (GRCm39) nonsense probably null
R9800:Speg UTSW 1 75,399,358 (GRCm39) missense probably benign 0.03
X0025:Speg UTSW 1 75,399,101 (GRCm39) missense probably damaging 1.00
X0026:Speg UTSW 1 75,400,119 (GRCm39) missense possibly damaging 0.88
Z1176:Speg UTSW 1 75,383,238 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,404,327 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,407,099 (GRCm39) missense probably damaging 0.99
Z1177:Speg UTSW 1 75,405,025 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGCTTCTTTCCTGGTTCATG -3'
(R):5'- GTCCATGAGGTAATAGCCCAGC -3'

Sequencing Primer
(F):5'- CATGATCTCTGGCTTGCCTGG -3'
(R):5'- GTAATAGCCCAGCCAGATGTTGC -3'
Posted On 2014-07-14