Mutagenetix > Incidental Mutation

Incidental Mutation 'R1936:Speg'

215756

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

MMRRC Submission

039954-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1936 (G1)

Quality Score

148

Status

Validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 75431408 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 3249 (T3249I)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037796] [ENSMUST00000087122] [ENSMUST00000113584] [ENSMUST00000131545] [ENSMUST00000133418] [ENSMUST00000140287] [ENSMUST00000141124] [ENSMUST00000143730] [ENSMUST00000144874] [ENSMUST00000145166]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000037796

SMART Domains

Protein: ENSMUSP00000035564
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	209	1.2e-30	PFAM
Pfam:NTP_transf_3	4	206	4.1e-10	PFAM
Pfam:Hexapep	280	321	2.6e-8	PFAM
low complexity region	357	365	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087122
AA Change: T3249I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: T3249I

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000113584

SMART Domains

Protein: ENSMUSP00000109214
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	209	1.6e-28	PFAM
Pfam:NTP_transf_3	4	206	1.6e-9	PFAM
Pfam:Hexapep	286	321	4.3e-8	PFAM
low complexity region	357	365	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000131545

SMART Domains

Protein: ENSMUSP00000120841
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	209	7.2e-31	PFAM
Pfam:NTP_transf_3	4	157	1.7e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133418

SMART Domains

Protein: ENSMUSP00000122443
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	209	6.8e-31	PFAM
Pfam:NTP_transf_3	4	204	1e-11	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000137868
AA Change: T2996I

Predicted Effect

probably benign
Transcript: ENSMUST00000140287

SMART Domains

Protein: ENSMUSP00000121552
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	161	1.7e-22	PFAM
Pfam:NTP_transf_3	4	155	6.1e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141124

SMART Domains

Protein: ENSMUSP00000116783
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	72	1.1e-13	PFAM
Pfam:NTP_transf_3	4	71	1.9e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143679

Predicted Effect

probably benign
Transcript: ENSMUST00000143730

SMART Domains

Protein: ENSMUSP00000114375
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	196	1.1e-30	PFAM
Pfam:NTP_transf_3	4	173	9.2e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144874

SMART Domains

Protein: ENSMUSP00000121418
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	1	174	6.6e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000145166

SMART Domains

Protein: ENSMUSP00000116754
Gene: ENSMUSG00000033021

Domain	Start	End	E-Value	Type
Pfam:NTP_transferase	3	91	5.2e-15	PFAM
Pfam:NTP_transf_3	4	88	1.4e-9	PFAM

Meta Mutation Damage Score

0.1890

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.5%

Validation Efficiency

99% (98/99)

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,917,080	Q226R	possibly damaging	Het
9930021J03Rik	A	G	19: 29,753,677	F712S	possibly damaging	Het
Abca13	G	A	11: 9,293,595	M1819I	probably benign	Het
Abca4	G	A	3: 122,052,923	V30M	probably benign	Het
Ablim1	T	A	19: 57,215,965		probably null	Het
Adgrf3	A	T	5: 30,202,306	N207K	probably benign	Het
Anapc4	T	A	5: 52,839,668	D94E	probably damaging	Het
Arfgef2	A	G	2: 166,863,603	N918S	probably benign	Het
Arhgap45	A	G	10: 80,030,954	N1097S	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
AU016765	G	A	17: 64,519,878		noncoding transcript	Het
Cacna2d2	T	C	9: 107,509,256	F194S	probably damaging	Het
Cacna2d4	A	G	6: 119,270,761	D341G	possibly damaging	Het
Ccdc129	G	T	6: 55,897,681	L205F	probably damaging	Het
Cdc42bpg	A	G	19: 6,310,309	Y175C	probably damaging	Het
Cep170b	G	T	12: 112,735,738	D322Y	probably damaging	Het
Cflar	T	A	1: 58,752,625	Y362*	probably null	Het
Chml	A	T	1: 175,687,259	C365*	probably null	Het
Clrn3	A	C	7: 135,514,024	I199S	possibly damaging	Het
Crtam	G	C	9: 41,004,550	P13A	probably benign	Het
Defb26	T	A	2: 152,508,275	K28N	possibly damaging	Het
Dennd1c	G	A	17: 57,073,889		probably benign	Het
Dgkz	A	T	2: 91,937,978	M761K	possibly damaging	Het
Dnhd1	A	T	7: 105,673,976	M564L	probably benign	Het
Dusp15	A	G	2: 152,945,421		probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eapp	A	T	12: 54,673,728	M234K	probably benign	Het
Epha8	T	C	4: 136,940,243	D309G	probably benign	Het
Gfi1b	T	C	2: 28,610,113	K302R	possibly damaging	Het
Gimap3	A	T	6: 48,765,749	F82L	probably damaging	Het
Gm4862	T	C	3: 139,128,492		noncoding transcript	Het
Gpatch1	A	G	7: 35,295,522	S440P	probably damaging	Het
Gpr152	A	G	19: 4,142,532	D24G	probably damaging	Het
Gpr6	T	C	10: 41,071,481	E35G	probably benign	Het
Hip1r	T	A	5: 123,996,071	M270K	probably damaging	Het
Hk3	C	T	13: 55,011,391	V451I	probably damaging	Het
Jag1	C	G	2: 137,083,473	V1070L	possibly damaging	Het
Klf16	G	A	10: 80,576,905	A99V	probably benign	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lvrn	A	T	18: 46,878,320	Y448F	probably benign	Het
Mark3	A	G	12: 111,618,365	M132V	probably damaging	Het
Mast3	A	G	8: 70,784,800	Y577H	probably damaging	Het
Med24	A	T	11: 98,718,816		probably null	Het
Mif	G	T	10: 75,859,847	H41N	possibly damaging	Het
Myo18b	T	C	5: 112,760,356	N2017S	probably benign	Het
Neurl4	C	T	11: 69,907,133	R740C	probably damaging	Het
Nlgn1	G	T	3: 26,331,790		probably benign	Het
Olfr1095	A	G	2: 86,851,401	M99T	probably benign	Het
Olfr288	T	A	15: 98,187,581	H72L	probably benign	Het
Olfr319	T	A	11: 58,702,346	L215Q	probably damaging	Het
Olfr870	A	G	9: 20,171,181	L130P	probably damaging	Het
Paip1	T	A	13: 119,457,014	M463K	probably damaging	Het
Parp3	T	A	9: 106,474,732	Y147F	probably damaging	Het
Pgrmc2	C	A	3: 41,083,038		probably benign	Het
Phldb3	G	A	7: 24,617,407	A278T	probably benign	Het
Plxnb1	T	C	9: 109,095,647		probably null	Het
Pphln1	A	G	15: 93,488,987	D234G	possibly damaging	Het
Prdm2	T	C	4: 143,134,462	S753G	probably benign	Het
Prss32	A	G	17: 23,856,050	R125G	possibly damaging	Het
Psg22	A	T	7: 18,719,710	N149I	probably damaging	Het
Psmd11	T	C	11: 80,428,744	L20P	probably damaging	Het
Recql5	T	C	11: 115,897,191	Y434C	probably benign	Het
Rexo1	A	G	10: 80,550,469	S252P	probably benign	Het
Sdr9c7	A	G	10: 127,903,634	K206R	probably benign	Het
Slc17a8	T	C	10: 89,577,915	M484V	probably benign	Het
Slc1a2	A	G	2: 102,777,605	N530D	probably benign	Het
Slc25a14	G	A	X: 48,651,963	V210I	probably benign	Het
Slc25a24	A	T	3: 109,136,265	E79D	probably damaging	Het
Smchd1	T	C	17: 71,463,791	Y132C	probably damaging	Het
Sorcs1	T	C	19: 50,232,644	D545G	probably damaging	Het
Sorcs2	A	G	5: 36,071,387	S104P	possibly damaging	Het
Spry4	A	G	18: 38,590,089	I207T	possibly damaging	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
Tdrd6	A	G	17: 43,626,467	L1230P	probably damaging	Het
Tesk2	A	G	4: 116,741,824	Y43C	probably benign	Het
Tex101	A	G	7: 24,668,225	V234A	probably benign	Het
Tmem161b	T	A	13: 84,293,466	L210Q	probably damaging	Het
Tmprss11f	T	A	5: 86,544,864	Q67L	probably benign	Het
Tnfrsf23	A	G	7: 143,668,554	F174L	probably benign	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Trdmt1	A	G	2: 13,511,609	L386P	probably damaging	Het
Trim25	A	T	11: 89,004,750	T206S	probably benign	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Trpc4	T	A	3: 54,279,890	M421K	probably damaging	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ttn	T	A	2: 76,747,178	D24457V	probably damaging	Het
Ttn	A	C	2: 76,885,490		probably benign	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Vmn2r94	G	A	17: 18,244,292	R579*	probably null	Het
Vps72	T	A	3: 95,122,540	V290D	probably benign	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Zfp26	A	G	9: 20,437,553	Y572H	probably benign	Het
Zfp292	A	G	4: 34,807,452	V1864A	probably benign	Het
Zfp952	A	T	17: 33,003,669	H374L	possibly damaging	Het
Zfy2	C	A	Y: 2,121,496	M132I	probably benign	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0483:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1759:Speg	UTSW	1	75401162	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75430477	missense	probably benign	0.30
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75387869	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6505:Speg	UTSW	1	75429523	missense	possibly damaging	0.93
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75406770	critical splice donor site	probably null
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75384835	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75431279	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75431309	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75402264	splice site	probably null
R8781:Speg	UTSW	1	75407021	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75405149	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75427438	critical splice donor site	probably null
R8881:Speg	UTSW	1	75401151	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75388873	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75422606	missense	probably benign	0.30
R9019:Speg	UTSW	1	75429238	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75388432	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75385010	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75422734	missense	probably benign	0.01
R9117:Speg	UTSW	1	75387800	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75390993	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75384854	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75421776	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75417733	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75422508	missense	probably benign
R9475:Speg	UTSW	1	75388091	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75415736	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75387803	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75422782	missense	probably benign	0.08
R9553:Speg	UTSW	1	75418001	missense	probably benign	0.00
R9767:Speg	UTSW	1	75427181	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75418973	nonsense	probably null
R9800:Speg	UTSW	1	75422714	missense	probably benign	0.03
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGAGCTTCTTTCCTGGTTCATG -3'
(R):5'- GTCCATGAGGTAATAGCCCAGC -3'

Sequencing Primer
(F):5'- CATGATCTCTGGCTTGCCTGG -3'
(R):5'- GTAATAGCCCAGCCAGATGTTGC -3'

Posted On

2014-07-14