Incidental Mutation 'R1936:Slc1a2'
ID215765
Institutional Source Beutler Lab
Gene Symbol Slc1a2
Ensembl Gene ENSMUSG00000005089
Gene Namesolute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms2900019G14Rik, 1700091C19Rik, MGLT1, GLT1, Eaat2, GLT-1
MMRRC Submission 039954-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R1936 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location102658659-102790784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102777605 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 530 (N530D)
Ref Sequence ENSEMBL: ENSMUSP00000106843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005220] [ENSMUST00000080210] [ENSMUST00000111212] [ENSMUST00000111213]
Predicted Effect probably benign
Transcript: ENSMUST00000005220
AA Change: N530D

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005220
Gene: ENSMUSG00000005089
AA Change: N530D

DomainStartEndE-ValueType
Pfam:SDF 43 492 8.9e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080210
AA Change: N533D

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000079100
Gene: ENSMUSG00000005089
AA Change: N533D

DomainStartEndE-ValueType
Pfam:SDF 46 495 3e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111212
AA Change: N530D

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106843
Gene: ENSMUSG00000005089
AA Change: N530D

DomainStartEndE-ValueType
Pfam:SDF 43 492 9.5e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111213
AA Change: N533D

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106844
Gene: ENSMUSG00000005089
AA Change: N533D

DomainStartEndE-ValueType
Pfam:SDF 46 495 2e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136488
SMART Domains Protein: ENSMUSP00000122094
Gene: ENSMUSG00000005089

DomainStartEndE-ValueType
Pfam:SDF 1 144 2.6e-53 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000154446
AA Change: N117D
SMART Domains Protein: ENSMUSP00000117549
Gene: ENSMUSG00000005089
AA Change: N117D

DomainStartEndE-ValueType
Pfam:SDF 1 80 5.5e-28 PFAM
Meta Mutation Damage Score 0.0918 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 99% (98/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of solute transporter proteins. The membrane-bound protein is the principal transporter that clears the excitatory neurotransmitter glutamate from the extracellular space at synapses in the central nervous system. Glutamate clearance is necessary for proper synaptic activation and to prevent neuronal damage from excessive activation of glutamate receptors. Mutations in and decreased expression of this protein are associated with amyotrophic lateral sclerosis. Alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display spontaneous seizures often leading to death as well as a succeptibility to neuronal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,917,080 Q226R possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Abca13 G A 11: 9,293,595 M1819I probably benign Het
Abca4 G A 3: 122,052,923 V30M probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Cacna2d4 A G 6: 119,270,761 D341G possibly damaging Het
Ccdc129 G T 6: 55,897,681 L205F probably damaging Het
Cdc42bpg A G 19: 6,310,309 Y175C probably damaging Het
Cep170b G T 12: 112,735,738 D322Y probably damaging Het
Cflar T A 1: 58,752,625 Y362* probably null Het
Chml A T 1: 175,687,259 C365* probably null Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dennd1c G A 17: 57,073,889 probably benign Het
Dgkz A T 2: 91,937,978 M761K possibly damaging Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Epha8 T C 4: 136,940,243 D309G probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gimap3 A T 6: 48,765,749 F82L probably damaging Het
Gm4862 T C 3: 139,128,492 noncoding transcript Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr152 A G 19: 4,142,532 D24G probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
Hip1r T A 5: 123,996,071 M270K probably damaging Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Mark3 A G 12: 111,618,365 M132V probably damaging Het
Mast3 A G 8: 70,784,800 Y577H probably damaging Het
Med24 A T 11: 98,718,816 probably null Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1095 A G 2: 86,851,401 M99T probably benign Het
Olfr288 T A 15: 98,187,581 H72L probably benign Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr870 A G 9: 20,171,181 L130P probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pphln1 A G 15: 93,488,987 D234G possibly damaging Het
Prdm2 T C 4: 143,134,462 S753G probably benign Het
Prss32 A G 17: 23,856,050 R125G possibly damaging Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Psmd11 T C 11: 80,428,744 L20P probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Sdr9c7 A G 10: 127,903,634 K206R probably benign Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Smchd1 T C 17: 71,463,791 Y132C probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Speg C T 1: 75,431,408 T3249I possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tdrd6 A G 17: 43,626,467 L1230P probably damaging Het
Tesk2 A G 4: 116,741,824 Y43C probably benign Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmprss11f T A 5: 86,544,864 Q67L probably benign Het
Tnfrsf23 A G 7: 143,668,554 F174L probably benign Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trim25 A T 11: 89,004,750 T206S probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trpc4 T A 3: 54,279,890 M421K probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vmn2r94 G A 17: 18,244,292 R579* probably null Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp26 A G 9: 20,437,553 Y572H probably benign Het
Zfp292 A G 4: 34,807,452 V1864A probably benign Het
Zfp952 A T 17: 33,003,669 H374L possibly damaging Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Slc1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Slc1a2 APN 2 102777576 missense possibly damaging 0.55
IGL00588:Slc1a2 APN 2 102756001 missense probably benign
IGL00931:Slc1a2 APN 2 102756112 missense probably damaging 1.00
IGL00942:Slc1a2 APN 2 102739814 missense probably damaging 1.00
IGL02100:Slc1a2 APN 2 102756089 missense probably damaging 1.00
IGL02173:Slc1a2 APN 2 102743861 missense probably benign 0.05
IGL02184:Slc1a2 APN 2 102748544 missense probably damaging 1.00
IGL02480:Slc1a2 APN 2 102736066 missense probably damaging 1.00
IGL02643:Slc1a2 APN 2 102739880 missense probably benign 0.30
IGL03332:Slc1a2 APN 2 102748534 missense possibly damaging 0.96
R0335:Slc1a2 UTSW 2 102743863 missense probably benign
R0544:Slc1a2 UTSW 2 102756072 missense probably damaging 0.99
R0570:Slc1a2 UTSW 2 102756007 missense probably damaging 1.00
R1472:Slc1a2 UTSW 2 102737909 missense probably damaging 1.00
R1536:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
R1856:Slc1a2 UTSW 2 102777567 missense probably damaging 0.97
R1965:Slc1a2 UTSW 2 102739900 missense probably damaging 1.00
R2270:Slc1a2 UTSW 2 102735994 missense probably damaging 1.00
R2365:Slc1a2 UTSW 2 102748453 intron probably null
R2567:Slc1a2 UTSW 2 102767010 missense probably damaging 1.00
R2878:Slc1a2 UTSW 2 102761167 missense probably damaging 1.00
R3080:Slc1a2 UTSW 2 102748556 missense probably damaging 1.00
R4716:Slc1a2 UTSW 2 102748538 missense probably damaging 0.96
R4744:Slc1a2 UTSW 2 102737869 missense probably benign 0.41
R5197:Slc1a2 UTSW 2 102756115 missense probably benign 0.02
R5835:Slc1a2 UTSW 2 102777450 missense probably damaging 1.00
R7077:Slc1a2 UTSW 2 102777510 missense probably benign 0.37
R7155:Slc1a2 UTSW 2 102766995 missense probably damaging 1.00
R7179:Slc1a2 UTSW 2 102755945 missense probably damaging 1.00
R7455:Slc1a2 UTSW 2 102735954 missense probably benign 0.16
R7492:Slc1a2 UTSW 2 102739930 nonsense probably null
R7818:Slc1a2 UTSW 2 102743956 missense probably benign 0.06
R7868:Slc1a2 UTSW 2 102761185 missense probably benign 0.06
R7951:Slc1a2 UTSW 2 102761185 missense probably benign 0.06
X0065:Slc1a2 UTSW 2 102737831 missense probably benign 0.12
Z1177:Slc1a2 UTSW 2 102761125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAAAGGGCAATTTCTAACGCAAC -3'
(R):5'- GAGCTTGGGTGACATGATTCC -3'

Sequencing Primer
(F):5'- GGGCAATTTCTAACGCAACCTTTG -3'
(R):5'- GGGTGACATGATTCCTTACAAAGC -3'
Posted On2014-07-14