Incidental Mutation 'R0129:Tsfm'
ID21578
Institutional Source Beutler Lab
Gene Symbol Tsfm
Ensembl Gene ENSMUSG00000040521
Gene NameTs translation elongation factor, mitochondrial
SynonymsEF-TS, 9430024O13Rik, 2310050B20Rik, EF-Tsmt
MMRRC Submission 038414-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0129 (G1)
Quality Score88
Status Validated (trace)
Chromosome10
Chromosomal Location127011572-127030840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127030470 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 74 (L74P)
Ref Sequence ENSEMBL: ENSMUSP00000113446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040560] [ENSMUST00000116231] [ENSMUST00000120547] [ENSMUST00000152054]
Predicted Effect probably benign
Transcript: ENSMUST00000040560
AA Change: L74P

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000042134
Gene: ENSMUSG00000040521
AA Change: L74P

DomainStartEndE-ValueType
low complexity region 38 52 N/A INTRINSIC
Pfam:EF_TS 115 273 9.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116231
SMART Domains Protein: ENSMUSP00000111939
Gene: ENSMUSG00000080115

DomainStartEndE-ValueType
Pfam:Methyltransf_16 35 198 4.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120547
AA Change: L74P

PolyPhen 2 Score 0.278 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113446
Gene: ENSMUSG00000040521
AA Change: L74P

DomainStartEndE-ValueType
Pfam:UBA 44 81 3.4e-10 PFAM
Pfam:EF_TS 101 192 1.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140564
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145476
Predicted Effect probably benign
Transcript: ENSMUST00000152054
AA Change: L74P

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521
AA Change: L74P

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Meta Mutation Damage Score 0.3395 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial translation elongation factor. The encoded protein is an enzyme that catalyzes the exchange of guanine nucleotides on the translation elongation factor Tu during the elongation step of mitchondrial protein translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-3 syndrome. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,787,194 D31G probably damaging Het
Actr2 A G 11: 20,100,939 probably benign Het
Adcy8 A G 15: 64,747,013 C764R probably benign Het
Ago4 A C 4: 126,517,183 F171C possibly damaging Het
Akt2 T C 7: 27,636,970 F408S probably damaging Het
Ankrd24 T C 10: 81,638,329 L26P probably damaging Het
Appl1 A T 14: 26,928,643 M524K probably damaging Het
Arhgef11 T A 3: 87,728,063 I922N probably damaging Het
Atp5h T C 11: 115,417,918 E47G probably damaging Het
Birc6 A G 17: 74,528,760 D70G probably benign Het
Bola2 G A 7: 126,696,559 V56M probably damaging Het
Ccdc151 G T 9: 21,993,552 R313S probably damaging Het
Cd300lg A G 11: 102,054,092 probably null Het
Cdc42bpb A G 12: 111,304,959 probably benign Het
Ceacam20 A G 7: 19,976,260 N403S probably damaging Het
Cenpf T C 1: 189,659,650 M662V probably benign Het
Chd3 C A 11: 69,348,501 E1607* probably null Het
Chtf18 A T 17: 25,727,311 Y9* probably null Het
Clta A G 4: 44,032,424 N200S probably benign Het
Csmd1 G A 8: 16,079,942 S1722F possibly damaging Het
Dennd4a T C 9: 64,893,294 S905P probably damaging Het
Dhx57 T C 17: 80,238,914 K1347R probably damaging Het
Dmc1 A T 15: 79,596,240 probably benign Het
Dnhd1 G T 7: 105,720,924 A4519S probably benign Het
Dnmbp A G 19: 43,850,027 C1120R probably benign Het
Efs C T 14: 54,917,223 A427T probably damaging Het
Erich6 T C 3: 58,624,378 E399G probably damaging Het
Espl1 A G 15: 102,316,648 T1431A probably benign Het
Fam184b A G 5: 45,532,778 S830P probably damaging Het
Fam49a C T 12: 12,362,349 T204I probably damaging Het
Herc1 T A 9: 66,448,075 C2203S probably damaging Het
Itpr1 G A 6: 108,349,676 V120M probably damaging Het
Kcnh7 G A 2: 62,716,159 T1026I probably benign Het
Kif1b A G 4: 149,261,201 I394T probably benign Het
Ldlrap1 A C 4: 134,757,422 V87G probably damaging Het
Lgals12 C T 19: 7,603,038 V155I probably damaging Het
Limch1 A T 5: 66,959,590 N116I probably damaging Het
Lonp2 C T 8: 86,634,890 R232C probably damaging Het
Lrch1 C A 14: 74,835,746 C151F probably benign Het
Lrig3 A G 10: 126,006,943 Y579C probably damaging Het
Macf1 T C 4: 123,433,275 S4808G probably damaging Het
Mapkap1 A T 2: 34,623,482 K501N probably damaging Het
Mdc1 G T 17: 35,854,445 R1523L probably benign Het
Mlh3 C T 12: 85,266,140 probably benign Het
Mul1 T C 4: 138,437,721 probably benign Het
Mybl2 G A 2: 163,059,491 probably benign Het
Notch1 G C 2: 26,460,458 H2223Q probably benign Het
Notch2 C A 3: 98,146,620 L2200M probably benign Het
Olfr1329 A T 4: 118,917,470 probably null Het
Olfr160 T C 9: 37,711,940 Y113C probably damaging Het
Olfr291 T A 7: 84,856,988 F206L probably benign Het
Olfr358 G A 2: 37,005,045 R190* probably null Het
Plekhs1 T C 19: 56,477,290 probably null Het
Ppm1h G A 10: 122,941,355 G509R probably damaging Het
Ppp2r3c C T 12: 55,298,422 E94K probably damaging Het
Ppp2r5e T A 12: 75,462,390 I372F probably damaging Het
Ptprt G A 2: 162,278,070 T159I probably benign Het
Rab20 A G 8: 11,454,415 F95S probably damaging Het
Rfc3 A C 5: 151,651,151 M1R probably null Het
Skp2 A G 15: 9,125,193 S100P probably damaging Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sspo A T 6: 48,455,418 T684S probably benign Het
Syt3 A G 7: 44,393,358 K355E probably damaging Het
Tcp10a A T 17: 7,343,504 K355N probably damaging Het
Tnrc18 A G 5: 142,765,045 probably benign Het
Ttn G C 2: 76,734,265 N28509K probably damaging Het
Ube2l6 G A 2: 84,798,908 M1I probably null Het
Vmn2r80 T A 10: 79,169,496 H322Q probably damaging Het
Zkscan8 A T 13: 21,522,271 S212T probably benign Het
Other mutations in Tsfm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Tsfm APN 10 127028442 nonsense probably null
IGL00910:Tsfm APN 10 127028359 intron probably benign
IGL01553:Tsfm APN 10 127028390 missense probably benign 0.01
R0123:Tsfm UTSW 10 127022929 intron probably benign
R0134:Tsfm UTSW 10 127022929 intron probably benign
R1689:Tsfm UTSW 10 127028455 missense probably damaging 1.00
R2004:Tsfm UTSW 10 127030794 missense probably damaging 1.00
R2144:Tsfm UTSW 10 127028445 nonsense probably null
R4574:Tsfm UTSW 10 127028373 missense probably damaging 0.99
R4690:Tsfm UTSW 10 127030678 intron probably benign
R5141:Tsfm UTSW 10 127029613 missense probably damaging 0.98
R5371:Tsfm UTSW 10 127011643 missense probably benign 0.03
R5801:Tsfm UTSW 10 127022837 frame shift probably null
R5949:Tsfm UTSW 10 127028375 missense probably damaging 1.00
R6959:Tsfm UTSW 10 127022909 missense probably benign 0.05
R7248:Tsfm UTSW 10 127011631 missense probably benign 0.31
R7499:Tsfm UTSW 10 127022548 missense possibly damaging 0.94
R7810:Tsfm UTSW 10 127011689 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTTCCAGTGAAAACGCAGTCG -3'
(R):5'- TCGCAGCAACTTTACCGCTAAGTC -3'

Sequencing Primer
(F):5'- CAGTCGAAGGGTAAAGCTCTC -3'
(R):5'- caggtggcagcatcctc -3'
Posted On2013-04-11