Mutagenetix > Incidental Mutation

Incidental Mutation 'R1936:Prdm2'

215785

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

039954-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1936 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 143134462 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 753 (S753G)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

AlphaFold

A2A7B5

Predicted Effect

probably benign
Transcript: ENSMUST00000105778
AA Change: S753G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: S753G

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197026

Meta Mutation Damage Score

0.0720

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.5%

Validation Efficiency

99% (98/99)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,917,080	Q226R	possibly damaging	Het
9930021J03Rik	A	G	19: 29,753,677	F712S	possibly damaging	Het
Abca13	G	A	11: 9,293,595	M1819I	probably benign	Het
Abca4	G	A	3: 122,052,923	V30M	probably benign	Het
Ablim1	T	A	19: 57,215,965		probably null	Het
Adgrf3	A	T	5: 30,202,306	N207K	probably benign	Het
Anapc4	T	A	5: 52,839,668	D94E	probably damaging	Het
Arfgef2	A	G	2: 166,863,603	N918S	probably benign	Het
Arhgap45	A	G	10: 80,030,954	N1097S	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
AU016765	G	A	17: 64,519,878		noncoding transcript	Het
Cacna2d2	T	C	9: 107,509,256	F194S	probably damaging	Het
Cacna2d4	A	G	6: 119,270,761	D341G	possibly damaging	Het
Ccdc129	G	T	6: 55,897,681	L205F	probably damaging	Het
Cdc42bpg	A	G	19: 6,310,309	Y175C	probably damaging	Het
Cep170b	G	T	12: 112,735,738	D322Y	probably damaging	Het
Cflar	T	A	1: 58,752,625	Y362*	probably null	Het
Chml	A	T	1: 175,687,259	C365*	probably null	Het
Clrn3	A	C	7: 135,514,024	I199S	possibly damaging	Het
Crtam	G	C	9: 41,004,550	P13A	probably benign	Het
Defb26	T	A	2: 152,508,275	K28N	possibly damaging	Het
Dennd1c	G	A	17: 57,073,889		probably benign	Het
Dgkz	A	T	2: 91,937,978	M761K	possibly damaging	Het
Dnhd1	A	T	7: 105,673,976	M564L	probably benign	Het
Dusp15	A	G	2: 152,945,421		probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eapp	A	T	12: 54,673,728	M234K	probably benign	Het
Epha8	T	C	4: 136,940,243	D309G	probably benign	Het
Gfi1b	T	C	2: 28,610,113	K302R	possibly damaging	Het
Gimap3	A	T	6: 48,765,749	F82L	probably damaging	Het
Gm4862	T	C	3: 139,128,492		noncoding transcript	Het
Gpatch1	A	G	7: 35,295,522	S440P	probably damaging	Het
Gpr152	A	G	19: 4,142,532	D24G	probably damaging	Het
Gpr6	T	C	10: 41,071,481	E35G	probably benign	Het
Hip1r	T	A	5: 123,996,071	M270K	probably damaging	Het
Hk3	C	T	13: 55,011,391	V451I	probably damaging	Het
Jag1	C	G	2: 137,083,473	V1070L	possibly damaging	Het
Klf16	G	A	10: 80,576,905	A99V	probably benign	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lvrn	A	T	18: 46,878,320	Y448F	probably benign	Het
Mark3	A	G	12: 111,618,365	M132V	probably damaging	Het
Mast3	A	G	8: 70,784,800	Y577H	probably damaging	Het
Med24	A	T	11: 98,718,816		probably null	Het
Mif	G	T	10: 75,859,847	H41N	possibly damaging	Het
Myo18b	T	C	5: 112,760,356	N2017S	probably benign	Het
Neurl4	C	T	11: 69,907,133	R740C	probably damaging	Het
Nlgn1	G	T	3: 26,331,790		probably benign	Het
Olfr1095	A	G	2: 86,851,401	M99T	probably benign	Het
Olfr288	T	A	15: 98,187,581	H72L	probably benign	Het
Olfr319	T	A	11: 58,702,346	L215Q	probably damaging	Het
Olfr870	A	G	9: 20,171,181	L130P	probably damaging	Het
Paip1	T	A	13: 119,457,014	M463K	probably damaging	Het
Parp3	T	A	9: 106,474,732	Y147F	probably damaging	Het
Pgrmc2	C	A	3: 41,083,038		probably benign	Het
Phldb3	G	A	7: 24,617,407	A278T	probably benign	Het
Plxnb1	T	C	9: 109,095,647		probably null	Het
Pphln1	A	G	15: 93,488,987	D234G	possibly damaging	Het
Prss32	A	G	17: 23,856,050	R125G	possibly damaging	Het
Psg22	A	T	7: 18,719,710	N149I	probably damaging	Het
Psmd11	T	C	11: 80,428,744	L20P	probably damaging	Het
Recql5	T	C	11: 115,897,191	Y434C	probably benign	Het
Rexo1	A	G	10: 80,550,469	S252P	probably benign	Het
Sdr9c7	A	G	10: 127,903,634	K206R	probably benign	Het
Slc17a8	T	C	10: 89,577,915	M484V	probably benign	Het
Slc1a2	A	G	2: 102,777,605	N530D	probably benign	Het
Slc25a14	G	A	X: 48,651,963	V210I	probably benign	Het
Slc25a24	A	T	3: 109,136,265	E79D	probably damaging	Het
Smchd1	T	C	17: 71,463,791	Y132C	probably damaging	Het
Sorcs1	T	C	19: 50,232,644	D545G	probably damaging	Het
Sorcs2	A	G	5: 36,071,387	S104P	possibly damaging	Het
Speg	C	T	1: 75,431,408	T3249I	possibly damaging	Het
Spry4	A	G	18: 38,590,089	I207T	possibly damaging	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
Tdrd6	A	G	17: 43,626,467	L1230P	probably damaging	Het
Tesk2	A	G	4: 116,741,824	Y43C	probably benign	Het
Tex101	A	G	7: 24,668,225	V234A	probably benign	Het
Tmem161b	T	A	13: 84,293,466	L210Q	probably damaging	Het
Tmprss11f	T	A	5: 86,544,864	Q67L	probably benign	Het
Tnfrsf23	A	G	7: 143,668,554	F174L	probably benign	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Trdmt1	A	G	2: 13,511,609	L386P	probably damaging	Het
Trim25	A	T	11: 89,004,750	T206S	probably benign	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Trpc4	T	A	3: 54,279,890	M421K	probably damaging	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ttn	T	A	2: 76,747,178	D24457V	probably damaging	Het
Ttn	A	C	2: 76,885,490		probably benign	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Vmn2r94	G	A	17: 18,244,292	R579*	probably null	Het
Vps72	T	A	3: 95,122,540	V290D	probably benign	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Zfp26	A	G	9: 20,437,553	Y572H	probably benign	Het
Zfp292	A	G	4: 34,807,452	V1864A	probably benign	Het
Zfp952	A	T	17: 33,003,669	H374L	possibly damaging	Het
Zfy2	C	A	Y: 2,121,496	M132I	probably benign	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R8887:Prdm2	UTSW	4	143134201	missense	probably damaging	1.00
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
R9518:Prdm2	UTSW	4	143134009	missense	possibly damaging	0.94
R9546:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
R9547:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
R9680:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R9730:Prdm2	UTSW	4	143132089	missense	possibly damaging	0.73
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTTCTGTTTGACACCGCTG -3'
(R):5'- TGACTCCTCCTGCAGGGATTTC -3'

Sequencing Primer
(F):5'- CTGTTTGACACCGCTGGATAAATC -3'
(R):5'- TCCTGCAGGGATTTCAACAG -3'

Posted On

2014-07-14