Mutagenetix > Incidental Mutation

Incidental Mutation 'R1936:Mast3'

215808

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

039954-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1936 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70784800 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 577 (Y577H)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: Y593H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: Y593H

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: Y577H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Meta Mutation Damage Score

0.9313

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.7%
20x: 93.5%

Validation Efficiency

99% (98/99)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	G	6: 91,917,080	Q226R	possibly damaging	Het
9930021J03Rik	A	G	19: 29,753,677	F712S	possibly damaging	Het
Abca13	G	A	11: 9,293,595	M1819I	probably benign	Het
Abca4	G	A	3: 122,052,923	V30M	probably benign	Het
Ablim1	T	A	19: 57,215,965		probably null	Het
Adgrf3	A	T	5: 30,202,306	N207K	probably benign	Het
Anapc4	T	A	5: 52,839,668	D94E	probably damaging	Het
Arfgef2	A	G	2: 166,863,603	N918S	probably benign	Het
Arhgap45	A	G	10: 80,030,954	N1097S	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
AU016765	G	A	17: 64,519,878		noncoding transcript	Het
Cacna2d2	T	C	9: 107,509,256	F194S	probably damaging	Het
Cacna2d4	A	G	6: 119,270,761	D341G	possibly damaging	Het
Ccdc129	G	T	6: 55,897,681	L205F	probably damaging	Het
Cdc42bpg	A	G	19: 6,310,309	Y175C	probably damaging	Het
Cep170b	G	T	12: 112,735,738	D322Y	probably damaging	Het
Cflar	T	A	1: 58,752,625	Y362*	probably null	Het
Chml	A	T	1: 175,687,259	C365*	probably null	Het
Clrn3	A	C	7: 135,514,024	I199S	possibly damaging	Het
Crtam	G	C	9: 41,004,550	P13A	probably benign	Het
Defb26	T	A	2: 152,508,275	K28N	possibly damaging	Het
Dennd1c	G	A	17: 57,073,889		probably benign	Het
Dgkz	A	T	2: 91,937,978	M761K	possibly damaging	Het
Dnhd1	A	T	7: 105,673,976	M564L	probably benign	Het
Dusp15	A	G	2: 152,945,421		probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eapp	A	T	12: 54,673,728	M234K	probably benign	Het
Epha8	T	C	4: 136,940,243	D309G	probably benign	Het
Gfi1b	T	C	2: 28,610,113	K302R	possibly damaging	Het
Gimap3	A	T	6: 48,765,749	F82L	probably damaging	Het
Gm4862	T	C	3: 139,128,492		noncoding transcript	Het
Gpatch1	A	G	7: 35,295,522	S440P	probably damaging	Het
Gpr152	A	G	19: 4,142,532	D24G	probably damaging	Het
Gpr6	T	C	10: 41,071,481	E35G	probably benign	Het
Hip1r	T	A	5: 123,996,071	M270K	probably damaging	Het
Hk3	C	T	13: 55,011,391	V451I	probably damaging	Het
Jag1	C	G	2: 137,083,473	V1070L	possibly damaging	Het
Klf16	G	A	10: 80,576,905	A99V	probably benign	Het
Lama5	T	C	2: 180,190,921	N1646S	probably benign	Het
Lvrn	A	T	18: 46,878,320	Y448F	probably benign	Het
Mark3	A	G	12: 111,618,365	M132V	probably damaging	Het
Med24	A	T	11: 98,718,816		probably null	Het
Mif	G	T	10: 75,859,847	H41N	possibly damaging	Het
Myo18b	T	C	5: 112,760,356	N2017S	probably benign	Het
Neurl4	C	T	11: 69,907,133	R740C	probably damaging	Het
Nlgn1	G	T	3: 26,331,790		probably benign	Het
Olfr1095	A	G	2: 86,851,401	M99T	probably benign	Het
Olfr288	T	A	15: 98,187,581	H72L	probably benign	Het
Olfr319	T	A	11: 58,702,346	L215Q	probably damaging	Het
Olfr870	A	G	9: 20,171,181	L130P	probably damaging	Het
Paip1	T	A	13: 119,457,014	M463K	probably damaging	Het
Parp3	T	A	9: 106,474,732	Y147F	probably damaging	Het
Pgrmc2	C	A	3: 41,083,038		probably benign	Het
Phldb3	G	A	7: 24,617,407	A278T	probably benign	Het
Plxnb1	T	C	9: 109,095,647		probably null	Het
Pphln1	A	G	15: 93,488,987	D234G	possibly damaging	Het
Prdm2	T	C	4: 143,134,462	S753G	probably benign	Het
Prss32	A	G	17: 23,856,050	R125G	possibly damaging	Het
Psg22	A	T	7: 18,719,710	N149I	probably damaging	Het
Psmd11	T	C	11: 80,428,744	L20P	probably damaging	Het
Recql5	T	C	11: 115,897,191	Y434C	probably benign	Het
Rexo1	A	G	10: 80,550,469	S252P	probably benign	Het
Sdr9c7	A	G	10: 127,903,634	K206R	probably benign	Het
Slc17a8	T	C	10: 89,577,915	M484V	probably benign	Het
Slc1a2	A	G	2: 102,777,605	N530D	probably benign	Het
Slc25a14	G	A	X: 48,651,963	V210I	probably benign	Het
Slc25a24	A	T	3: 109,136,265	E79D	probably damaging	Het
Smchd1	T	C	17: 71,463,791	Y132C	probably damaging	Het
Sorcs1	T	C	19: 50,232,644	D545G	probably damaging	Het
Sorcs2	A	G	5: 36,071,387	S104P	possibly damaging	Het
Speg	C	T	1: 75,431,408	T3249I	possibly damaging	Het
Spry4	A	G	18: 38,590,089	I207T	possibly damaging	Het
Srsf6	C	T	2: 162,934,483		probably benign	Het
Tdrd6	A	G	17: 43,626,467	L1230P	probably damaging	Het
Tesk2	A	G	4: 116,741,824	Y43C	probably benign	Het
Tex101	A	G	7: 24,668,225	V234A	probably benign	Het
Tmem161b	T	A	13: 84,293,466	L210Q	probably damaging	Het
Tmprss11f	T	A	5: 86,544,864	Q67L	probably benign	Het
Tnfrsf23	A	G	7: 143,668,554	F174L	probably benign	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Trdmt1	A	G	2: 13,511,609	L386P	probably damaging	Het
Trim25	A	T	11: 89,004,750	T206S	probably benign	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Trpc4	T	A	3: 54,279,890	M421K	probably damaging	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ttn	T	A	2: 76,747,178	D24457V	probably damaging	Het
Ttn	A	C	2: 76,885,490		probably benign	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Vmn2r94	G	A	17: 18,244,292	R579*	probably null	Het
Vps72	T	A	3: 95,122,540	V290D	probably benign	Het
Wipf2	C	T	11: 98,892,410	R221*	probably null	Het
Zfp26	A	G	9: 20,437,553	Y572H	probably benign	Het
Zfp292	A	G	4: 34,807,452	V1864A	probably benign	Het
Zfp952	A	T	17: 33,003,669	H374L	possibly damaging	Het
Zfy2	C	A	Y: 2,121,496	M132I	probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGGCCACATGATCTCATCTG -3'
(R):5'- GGGGCTAGCCTCATTTCTCATG -3'

Sequencing Primer
(F):5'- ACATGATCTCATCTGAAGTTCCGGG -3'
(R):5'- AGCCTCATTTCTCATGTGTGTAG -3'

Posted On

2014-07-14