Incidental Mutation 'R1936:Mast3'
ID 215808
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 039954-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1936 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71237444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 577 (Y577H)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
AlphaFold Q3U214
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: Y593H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: Y593H

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: Y577H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Meta Mutation Damage Score 0.9313 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 99% (98/99)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,894,061 (GRCm39) Q226R possibly damaging Het
Abca13 G A 11: 9,243,595 (GRCm39) M1819I probably benign Het
Abca4 G A 3: 121,846,572 (GRCm39) V30M probably benign Het
Ablim1 T A 19: 57,204,397 (GRCm39) probably null Het
Adgrf3 A T 5: 30,407,304 (GRCm39) N207K probably benign Het
Anapc4 T A 5: 52,997,010 (GRCm39) D94E probably damaging Het
Arfgef2 A G 2: 166,705,523 (GRCm39) N918S probably benign Het
Arhgap45 A G 10: 79,866,788 (GRCm39) N1097S probably damaging Het
Atp8a2 T C 14: 60,097,719 (GRCm39) K770E probably benign Het
AU016765 G A 17: 64,826,873 (GRCm39) noncoding transcript Het
Brd10 A G 19: 29,731,077 (GRCm39) F712S possibly damaging Het
Cacna2d2 T C 9: 107,386,455 (GRCm39) F194S probably damaging Het
Cacna2d4 A G 6: 119,247,722 (GRCm39) D341G possibly damaging Het
Cdc42bpg A G 19: 6,360,339 (GRCm39) Y175C probably damaging Het
Cep170b G T 12: 112,702,172 (GRCm39) D322Y probably damaging Het
Cflar T A 1: 58,791,784 (GRCm39) Y362* probably null Het
Chml A T 1: 175,514,825 (GRCm39) C365* probably null Het
Clrn3 A C 7: 135,115,753 (GRCm39) I199S possibly damaging Het
Crtam G C 9: 40,915,846 (GRCm39) P13A probably benign Het
Defb26 T A 2: 152,350,195 (GRCm39) K28N possibly damaging Het
Dennd1c G A 17: 57,380,889 (GRCm39) probably benign Het
Dgkz A T 2: 91,768,323 (GRCm39) M761K possibly damaging Het
Dnhd1 A T 7: 105,323,183 (GRCm39) M564L probably benign Het
Dusp15 A G 2: 152,787,341 (GRCm39) probably benign Het
Dync2h1 A G 9: 7,139,159 (GRCm39) probably null Het
Eapp A T 12: 54,720,513 (GRCm39) M234K probably benign Het
Epha8 T C 4: 136,667,554 (GRCm39) D309G probably benign Het
Gfi1b T C 2: 28,500,125 (GRCm39) K302R possibly damaging Het
Gimap3 A T 6: 48,742,683 (GRCm39) F82L probably damaging Het
Gm4862 T C 3: 138,834,253 (GRCm39) noncoding transcript Het
Gpatch1 A G 7: 34,994,947 (GRCm39) S440P probably damaging Het
Gpr152 A G 19: 4,192,531 (GRCm39) D24G probably damaging Het
Gpr6 T C 10: 40,947,477 (GRCm39) E35G probably benign Het
Hip1r T A 5: 124,134,134 (GRCm39) M270K probably damaging Het
Hk3 C T 13: 55,159,204 (GRCm39) V451I probably damaging Het
Itprid1 G T 6: 55,874,666 (GRCm39) L205F probably damaging Het
Jag1 C G 2: 136,925,393 (GRCm39) V1070L possibly damaging Het
Klf16 G A 10: 80,412,739 (GRCm39) A99V probably benign Het
Lama5 T C 2: 179,832,714 (GRCm39) N1646S probably benign Het
Lvrn A T 18: 47,011,387 (GRCm39) Y448F probably benign Het
Mark3 A G 12: 111,584,799 (GRCm39) M132V probably damaging Het
Med24 A T 11: 98,609,642 (GRCm39) probably null Het
Mif G T 10: 75,695,681 (GRCm39) H41N possibly damaging Het
Myo18b T C 5: 112,908,222 (GRCm39) N2017S probably benign Het
Neurl4 C T 11: 69,797,959 (GRCm39) R740C probably damaging Het
Nlgn1 G T 3: 26,385,939 (GRCm39) probably benign Het
Or10ad1c T A 15: 98,085,462 (GRCm39) H72L probably benign Het
Or2ak6 T A 11: 58,593,172 (GRCm39) L215Q probably damaging Het
Or5t15 A G 2: 86,681,745 (GRCm39) M99T probably benign Het
Or8b12i A G 9: 20,082,477 (GRCm39) L130P probably damaging Het
Paip1 T A 13: 119,593,550 (GRCm39) M463K probably damaging Het
Parp3 T A 9: 106,351,931 (GRCm39) Y147F probably damaging Het
Pgrmc2 C A 3: 41,037,473 (GRCm39) probably benign Het
Phldb3 G A 7: 24,316,832 (GRCm39) A278T probably benign Het
Plxnb1 T C 9: 108,924,715 (GRCm39) probably null Het
Pphln1 A G 15: 93,386,868 (GRCm39) D234G possibly damaging Het
Prdm2 T C 4: 142,861,032 (GRCm39) S753G probably benign Het
Prss32 A G 17: 24,075,024 (GRCm39) R125G possibly damaging Het
Psg22 A T 7: 18,453,635 (GRCm39) N149I probably damaging Het
Psmd11 T C 11: 80,319,570 (GRCm39) L20P probably damaging Het
Recql5 T C 11: 115,788,017 (GRCm39) Y434C probably benign Het
Rexo1 A G 10: 80,386,303 (GRCm39) S252P probably benign Het
Sdr9c7 A G 10: 127,739,503 (GRCm39) K206R probably benign Het
Slc17a8 T C 10: 89,413,777 (GRCm39) M484V probably benign Het
Slc1a2 A G 2: 102,607,950 (GRCm39) N530D probably benign Het
Slc25a14 G A X: 47,740,840 (GRCm39) V210I probably benign Het
Slc25a24 A T 3: 109,043,581 (GRCm39) E79D probably damaging Het
Smchd1 T C 17: 71,770,786 (GRCm39) Y132C probably damaging Het
Sorcs1 T C 19: 50,221,082 (GRCm39) D545G probably damaging Het
Sorcs2 A G 5: 36,228,731 (GRCm39) S104P possibly damaging Het
Speg C T 1: 75,408,052 (GRCm39) T3249I possibly damaging Het
Spry4 A G 18: 38,723,142 (GRCm39) I207T possibly damaging Het
Srsf6 C T 2: 162,776,403 (GRCm39) probably benign Het
Tdrd6 A G 17: 43,937,358 (GRCm39) L1230P probably damaging Het
Tesk2 A G 4: 116,599,021 (GRCm39) Y43C probably benign Het
Tex101 A G 7: 24,367,650 (GRCm39) V234A probably benign Het
Tmem161b T A 13: 84,441,585 (GRCm39) L210Q probably damaging Het
Tmprss11f T A 5: 86,692,723 (GRCm39) Q67L probably benign Het
Tnfrsf23 A G 7: 143,222,291 (GRCm39) F174L probably benign Het
Tnrc6c A G 11: 117,646,849 (GRCm39) D1450G possibly damaging Het
Trdmt1 A G 2: 13,516,420 (GRCm39) L386P probably damaging Het
Trim25 A T 11: 88,895,576 (GRCm39) T206S probably benign Het
Trit1 T C 4: 122,948,033 (GRCm39) I451T probably benign Het
Trpc4 T A 3: 54,187,311 (GRCm39) M421K probably damaging Het
Ttc34 G A 4: 154,950,139 (GRCm39) A1031T possibly damaging Het
Ttn A C 2: 76,715,834 (GRCm39) probably benign Het
Ttn T A 2: 76,577,522 (GRCm39) D24457V probably damaging Het
Ubiad1 A G 4: 148,528,468 (GRCm39) L147P probably damaging Het
Vmn2r94 G A 17: 18,464,554 (GRCm39) R579* probably null Het
Vps72 T A 3: 95,029,851 (GRCm39) V290D probably benign Het
Wipf2 C T 11: 98,783,236 (GRCm39) R221* probably null Het
Zfp26 A G 9: 20,348,849 (GRCm39) Y572H probably benign Het
Zfp292 A G 4: 34,807,452 (GRCm39) V1864A probably benign Het
Zfp952 A T 17: 33,222,643 (GRCm39) H374L possibly damaging Het
Zfy2 C A Y: 2,121,496 (GRCm39) M132I probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGGCCACATGATCTCATCTG -3'
(R):5'- GGGGCTAGCCTCATTTCTCATG -3'

Sequencing Primer
(F):5'- ACATGATCTCATCTGAAGTTCCGGG -3'
(R):5'- AGCCTCATTTCTCATGTGTGTAG -3'
Posted On 2014-07-14