Incidental Mutation 'R0129:Fam49a'
ID21582
Institutional Source Beutler Lab
Gene Symbol Fam49a
Ensembl Gene ENSMUSG00000020589
Gene Namefamily with sequence similarity 49, member A
Synonyms2410157M17Rik, D12Ertd553e
MMRRC Submission 038414-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R0129 (G1)
Quality Score211
Status Validated (trace)
Chromosome12
Chromosomal Location12262139-12380965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12362349 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 204 (T204I)
Ref Sequence ENSEMBL: ENSMUSP00000152252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069005] [ENSMUST00000069066] [ENSMUST00000223061]
Predicted Effect probably damaging
Transcript: ENSMUST00000069005
AA Change: T204I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000068125
Gene: ENSMUSG00000020589
AA Change: T204I

DomainStartEndE-ValueType
Pfam:DUF1394 17 319 2.1e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000069066
AA Change: T204I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065613
Gene: ENSMUSG00000020589
AA Change: T204I

DomainStartEndE-ValueType
Pfam:DUF1394 15 319 1.9e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220545
Predicted Effect probably damaging
Transcript: ENSMUST00000223061
AA Change: T204I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Meta Mutation Damage Score 0.8498 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,787,194 D31G probably damaging Het
Actr2 A G 11: 20,100,939 probably benign Het
Adcy8 A G 15: 64,747,013 C764R probably benign Het
Ago4 A C 4: 126,517,183 F171C possibly damaging Het
Akt2 T C 7: 27,636,970 F408S probably damaging Het
Ankrd24 T C 10: 81,638,329 L26P probably damaging Het
Appl1 A T 14: 26,928,643 M524K probably damaging Het
Arhgef11 T A 3: 87,728,063 I922N probably damaging Het
Atp5h T C 11: 115,417,918 E47G probably damaging Het
Birc6 A G 17: 74,528,760 D70G probably benign Het
Bola2 G A 7: 126,696,559 V56M probably damaging Het
Ccdc151 G T 9: 21,993,552 R313S probably damaging Het
Cd300lg A G 11: 102,054,092 probably null Het
Cdc42bpb A G 12: 111,304,959 probably benign Het
Ceacam20 A G 7: 19,976,260 N403S probably damaging Het
Cenpf T C 1: 189,659,650 M662V probably benign Het
Chd3 C A 11: 69,348,501 E1607* probably null Het
Chtf18 A T 17: 25,727,311 Y9* probably null Het
Clta A G 4: 44,032,424 N200S probably benign Het
Csmd1 G A 8: 16,079,942 S1722F possibly damaging Het
Dennd4a T C 9: 64,893,294 S905P probably damaging Het
Dhx57 T C 17: 80,238,914 K1347R probably damaging Het
Dmc1 A T 15: 79,596,240 probably benign Het
Dnhd1 G T 7: 105,720,924 A4519S probably benign Het
Dnmbp A G 19: 43,850,027 C1120R probably benign Het
Efs C T 14: 54,917,223 A427T probably damaging Het
Erich6 T C 3: 58,624,378 E399G probably damaging Het
Espl1 A G 15: 102,316,648 T1431A probably benign Het
Fam184b A G 5: 45,532,778 S830P probably damaging Het
Herc1 T A 9: 66,448,075 C2203S probably damaging Het
Itpr1 G A 6: 108,349,676 V120M probably damaging Het
Kcnh7 G A 2: 62,716,159 T1026I probably benign Het
Kif1b A G 4: 149,261,201 I394T probably benign Het
Ldlrap1 A C 4: 134,757,422 V87G probably damaging Het
Lgals12 C T 19: 7,603,038 V155I probably damaging Het
Limch1 A T 5: 66,959,590 N116I probably damaging Het
Lonp2 C T 8: 86,634,890 R232C probably damaging Het
Lrch1 C A 14: 74,835,746 C151F probably benign Het
Lrig3 A G 10: 126,006,943 Y579C probably damaging Het
Macf1 T C 4: 123,433,275 S4808G probably damaging Het
Mapkap1 A T 2: 34,623,482 K501N probably damaging Het
Mdc1 G T 17: 35,854,445 R1523L probably benign Het
Mlh3 C T 12: 85,266,140 probably benign Het
Mul1 T C 4: 138,437,721 probably benign Het
Mybl2 G A 2: 163,059,491 probably benign Het
Notch1 G C 2: 26,460,458 H2223Q probably benign Het
Notch2 C A 3: 98,146,620 L2200M probably benign Het
Olfr1329 A T 4: 118,917,470 probably null Het
Olfr160 T C 9: 37,711,940 Y113C probably damaging Het
Olfr291 T A 7: 84,856,988 F206L probably benign Het
Olfr358 G A 2: 37,005,045 R190* probably null Het
Plekhs1 T C 19: 56,477,290 probably null Het
Ppm1h G A 10: 122,941,355 G509R probably damaging Het
Ppp2r3c C T 12: 55,298,422 E94K probably damaging Het
Ppp2r5e T A 12: 75,462,390 I372F probably damaging Het
Ptprt G A 2: 162,278,070 T159I probably benign Het
Rab20 A G 8: 11,454,415 F95S probably damaging Het
Rfc3 A C 5: 151,651,151 M1R probably null Het
Skp2 A G 15: 9,125,193 S100P probably damaging Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sspo A T 6: 48,455,418 T684S probably benign Het
Syt3 A G 7: 44,393,358 K355E probably damaging Het
Tcp10a A T 17: 7,343,504 K355N probably damaging Het
Tnrc18 A G 5: 142,765,045 probably benign Het
Tsfm A G 10: 127,030,470 L74P probably benign Het
Ttn G C 2: 76,734,265 N28509K probably damaging Het
Ube2l6 G A 2: 84,798,908 M1I probably null Het
Vmn2r80 T A 10: 79,169,496 H322Q probably damaging Het
Zkscan8 A T 13: 21,522,271 S212T probably benign Het
Other mutations in Fam49a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Fam49a APN 12 12359234 missense probably benign
IGL01614:Fam49a APN 12 12361573 critical splice donor site probably null
IGL02313:Fam49a APN 12 12364751 missense possibly damaging 0.93
R1807:Fam49a UTSW 12 12361504 missense probably benign 0.01
R2017:Fam49a UTSW 12 12362361 missense probably damaging 1.00
R3893:Fam49a UTSW 12 12362525 missense probably benign 0.21
R5816:Fam49a UTSW 12 12358165 missense probably benign 0.33
R7169:Fam49a UTSW 12 12359232 missense possibly damaging 0.81
R7363:Fam49a UTSW 12 12340664 splice site probably null
R7522:Fam49a UTSW 12 12358056 missense possibly damaging 0.93
R7877:Fam49a UTSW 12 12364797 missense probably benign 0.37
R8061:Fam49a UTSW 12 12362027 missense possibly damaging 0.55
RF015:Fam49a UTSW 12 12369938 missense probably benign
X0017:Fam49a UTSW 12 12362069 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGAACCCCGCTATTCAGAATGAC -3'
(R):5'- TCCAGCATGACTTTACAGACGCTTG -3'

Sequencing Primer
(F):5'- AAGGCAGAGTCCTTGTCTATAGC -3'
(R):5'- AGACGCTTGTCATCGTACTGAG -3'
Posted On2013-04-11