Incidental Mutation 'R1936:Trim25'
ID215829
Institutional Source Beutler Lab
Gene Symbol Trim25
Ensembl Gene ENSMUSG00000000275
Gene Nametripartite motif-containing 25
Synonymsestrogen-responsive finger protein, Zfp147
MMRRC Submission 039954-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1936 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location88999376-89020293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89004750 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 206 (T206S)
Ref Sequence ENSEMBL: ENSMUSP00000098192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000284] [ENSMUST00000100627] [ENSMUST00000107896]
Predicted Effect probably benign
Transcript: ENSMUST00000000284
AA Change: T206S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000000284
Gene: ENSMUSG00000000275
AA Change: T206S

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 5e-34 BLAST
PDB:4LTB|B 189 380 7e-69 PDB
PRY 453 505 3.44e-17 SMART
SPRY 506 626 9.62e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100627
AA Change: T206S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098192
Gene: ENSMUSG00000000275
AA Change: T206S

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:BBOX 151 186 3e-8 BLAST
Blast:SPEC 189 288 2e-37 BLAST
PDB:4LTB|B 189 380 2e-71 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107896
AA Change: T206S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103528
Gene: ENSMUSG00000000275
AA Change: T206S

DomainStartEndE-ValueType
RING 13 53 8.04e-9 SMART
Blast:SPEC 189 288 3e-34 BLAST
PDB:4LTB|B 189 380 8e-69 PDB
low complexity region 382 393 N/A INTRINSIC
PRY 461 513 3.44e-17 SMART
SPRY 514 634 9.62e-31 SMART
Meta Mutation Damage Score 0.0593 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 99% (98/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to the cytoplasm. The presence of potential DNA-binding and dimerization-transactivation domains suggests that this protein may act as a transcription factor, similar to several other members of the TRIM family. Expression of the gene is upregulated in response to estrogen, and it is thought to mediate estrogen actions in breast cancer as a primary response gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations result in a compromised response to estrogen resulting in functional but small uteri. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,917,080 Q226R possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Abca13 G A 11: 9,293,595 M1819I probably benign Het
Abca4 G A 3: 122,052,923 V30M probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Cacna2d4 A G 6: 119,270,761 D341G possibly damaging Het
Ccdc129 G T 6: 55,897,681 L205F probably damaging Het
Cdc42bpg A G 19: 6,310,309 Y175C probably damaging Het
Cep170b G T 12: 112,735,738 D322Y probably damaging Het
Cflar T A 1: 58,752,625 Y362* probably null Het
Chml A T 1: 175,687,259 C365* probably null Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dennd1c G A 17: 57,073,889 probably benign Het
Dgkz A T 2: 91,937,978 M761K possibly damaging Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Epha8 T C 4: 136,940,243 D309G probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gimap3 A T 6: 48,765,749 F82L probably damaging Het
Gm4862 T C 3: 139,128,492 noncoding transcript Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr152 A G 19: 4,142,532 D24G probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
Hip1r T A 5: 123,996,071 M270K probably damaging Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Mark3 A G 12: 111,618,365 M132V probably damaging Het
Mast3 A G 8: 70,784,800 Y577H probably damaging Het
Med24 A T 11: 98,718,816 probably null Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1095 A G 2: 86,851,401 M99T probably benign Het
Olfr288 T A 15: 98,187,581 H72L probably benign Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr870 A G 9: 20,171,181 L130P probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pphln1 A G 15: 93,488,987 D234G possibly damaging Het
Prdm2 T C 4: 143,134,462 S753G probably benign Het
Prss32 A G 17: 23,856,050 R125G possibly damaging Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Psmd11 T C 11: 80,428,744 L20P probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Sdr9c7 A G 10: 127,903,634 K206R probably benign Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc1a2 A G 2: 102,777,605 N530D probably benign Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Smchd1 T C 17: 71,463,791 Y132C probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Speg C T 1: 75,431,408 T3249I possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tdrd6 A G 17: 43,626,467 L1230P probably damaging Het
Tesk2 A G 4: 116,741,824 Y43C probably benign Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmprss11f T A 5: 86,544,864 Q67L probably benign Het
Tnfrsf23 A G 7: 143,668,554 F174L probably benign Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trpc4 T A 3: 54,279,890 M421K probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vmn2r94 G A 17: 18,244,292 R579* probably null Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp26 A G 9: 20,437,553 Y572H probably benign Het
Zfp292 A G 4: 34,807,452 V1864A probably benign Het
Zfp952 A T 17: 33,003,669 H374L possibly damaging Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Trim25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Trim25 APN 11 88999691 missense probably damaging 0.96
IGL02398:Trim25 APN 11 88999804 missense probably damaging 1.00
IGL03150:Trim25 APN 11 89000005 missense probably damaging 1.00
R0003:Trim25 UTSW 11 89015772 missense probably benign 0.01
R0184:Trim25 UTSW 11 88999640 missense probably damaging 1.00
R0707:Trim25 UTSW 11 88999738 missense probably benign 0.03
R1855:Trim25 UTSW 11 89015581 missense probably benign 0.04
R2229:Trim25 UTSW 11 89016621 missense probably damaging 0.97
R3401:Trim25 UTSW 11 89010881 missense probably benign
R5159:Trim25 UTSW 11 88999532 missense probably benign 0.20
R5378:Trim25 UTSW 11 89009267 missense probably damaging 1.00
R6149:Trim25 UTSW 11 89015536 missense probably benign 0.00
R6867:Trim25 UTSW 11 89010887 missense probably benign 0.00
R6996:Trim25 UTSW 11 88999503 missense probably benign 0.00
R7055:Trim25 UTSW 11 88999924 missense probably benign
R7310:Trim25 UTSW 11 89015782 missense probably benign 0.03
R7451:Trim25 UTSW 11 89015737 missense possibly damaging 0.76
R7632:Trim25 UTSW 11 89015776 missense probably null 0.91
R7767:Trim25 UTSW 11 89009117 critical splice acceptor site probably null
X0022:Trim25 UTSW 11 89015596 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGTCATTTTGGTTCCAAGTCTT -3'
(R):5'- AGTTTCCTGCATTGGGGTGC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- ACTTTGTAAACCAGGCTGGC -3'
Posted On2014-07-14