Incidental Mutation 'R1936:Pphln1'
ID215844
Institutional Source Beutler Lab
Gene Symbol Pphln1
Ensembl Gene ENSMUSG00000036167
Gene Nameperiphilin 1
SynonymsCR, 1600022A19Rik, 1110063K05Rik
MMRRC Submission 039954-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1936 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location93398350-93491510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93488987 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 234 (D234G)
Ref Sequence ENSEMBL: ENSMUSP00000154876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049122] [ENSMUST00000068457] [ENSMUST00000109256] [ENSMUST00000165935] [ENSMUST00000229071]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049122
AA Change: D322G

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042762
Gene: ENSMUSG00000036167
AA Change: D322G

DomainStartEndE-ValueType
low complexity region 35 59 N/A INTRINSIC
low complexity region 154 174 N/A INTRINSIC
low complexity region 215 231 N/A INTRINSIC
Pfam:Lge1 275 365 2.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000068457
AA Change: D253G

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000068165
Gene: ENSMUSG00000036167
AA Change: D253G

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 146 162 N/A INTRINSIC
Pfam:Lge1 179 297 8.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109256
AA Change: D234G

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104879
Gene: ENSMUSG00000036167
AA Change: D234G

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165935
AA Change: D234G

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131121
Gene: ENSMUSG00000036167
AA Change: D234G

DomainStartEndE-ValueType
low complexity region 85 105 N/A INTRINSIC
low complexity region 127 143 N/A INTRINSIC
Pfam:Lge1 160 278 7.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000229071
AA Change: D234G

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.7438 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 99% (98/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the several proteins that become sequentially incorporated into the cornified cell envelope during the terminal differentiation of keratinocyte at the outer layers of epidermis. This protein interacts with periplakin, which is known as a precursor of the cornified cell envelope. The cellular localization pattern and insolubility of this protein suggest that it may play a role in epithelial differentiation and contribute to epidermal integrity and barrier formation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,917,080 Q226R possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Abca13 G A 11: 9,293,595 M1819I probably benign Het
Abca4 G A 3: 122,052,923 V30M probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Cacna2d4 A G 6: 119,270,761 D341G possibly damaging Het
Ccdc129 G T 6: 55,897,681 L205F probably damaging Het
Cdc42bpg A G 19: 6,310,309 Y175C probably damaging Het
Cep170b G T 12: 112,735,738 D322Y probably damaging Het
Cflar T A 1: 58,752,625 Y362* probably null Het
Chml A T 1: 175,687,259 C365* probably null Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dennd1c G A 17: 57,073,889 probably benign Het
Dgkz A T 2: 91,937,978 M761K possibly damaging Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Epha8 T C 4: 136,940,243 D309G probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gimap3 A T 6: 48,765,749 F82L probably damaging Het
Gm4862 T C 3: 139,128,492 noncoding transcript Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr152 A G 19: 4,142,532 D24G probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
Hip1r T A 5: 123,996,071 M270K probably damaging Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Mark3 A G 12: 111,618,365 M132V probably damaging Het
Mast3 A G 8: 70,784,800 Y577H probably damaging Het
Med24 A T 11: 98,718,816 probably null Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1095 A G 2: 86,851,401 M99T probably benign Het
Olfr288 T A 15: 98,187,581 H72L probably benign Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr870 A G 9: 20,171,181 L130P probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Prdm2 T C 4: 143,134,462 S753G probably benign Het
Prss32 A G 17: 23,856,050 R125G possibly damaging Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Psmd11 T C 11: 80,428,744 L20P probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Sdr9c7 A G 10: 127,903,634 K206R probably benign Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc1a2 A G 2: 102,777,605 N530D probably benign Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Smchd1 T C 17: 71,463,791 Y132C probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Speg C T 1: 75,431,408 T3249I possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tdrd6 A G 17: 43,626,467 L1230P probably damaging Het
Tesk2 A G 4: 116,741,824 Y43C probably benign Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmprss11f T A 5: 86,544,864 Q67L probably benign Het
Tnfrsf23 A G 7: 143,668,554 F174L probably benign Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trim25 A T 11: 89,004,750 T206S probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trpc4 T A 3: 54,279,890 M421K probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vmn2r94 G A 17: 18,244,292 R579* probably null Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp26 A G 9: 20,437,553 Y572H probably benign Het
Zfp292 A G 4: 34,807,452 V1864A probably benign Het
Zfp952 A T 17: 33,003,669 H374L possibly damaging Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Pphln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Pphln1 APN 15 93465210 missense probably damaging 1.00
IGL01305:Pphln1 APN 15 93489104 missense probably damaging 1.00
IGL01651:Pphln1 APN 15 93488983 missense probably damaging 1.00
IGL03219:Pphln1 APN 15 93465255 splice site probably benign
ANU22:Pphln1 UTSW 15 93489104 missense probably damaging 1.00
R0294:Pphln1 UTSW 15 93420290 missense probably damaging 1.00
R0309:Pphln1 UTSW 15 93441707 missense possibly damaging 0.55
R0645:Pphln1 UTSW 15 93420311 missense possibly damaging 0.80
R1208:Pphln1 UTSW 15 93459729 missense probably damaging 1.00
R1208:Pphln1 UTSW 15 93459729 missense probably damaging 1.00
R1879:Pphln1 UTSW 15 93424046 missense probably damaging 0.99
R4049:Pphln1 UTSW 15 93465106 missense probably damaging 0.99
R5034:Pphln1 UTSW 15 93452129 missense probably benign
R5472:Pphln1 UTSW 15 93488975 missense possibly damaging 0.89
R5945:Pphln1 UTSW 15 93455532 critical splice donor site probably null
R7116:Pphln1 UTSW 15 93455525 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCCAAGTGTAAAGCCCTGTG -3'
(R):5'- CCAAAGTCCTGAGCAGAGTTG -3'

Sequencing Primer
(F):5'- ATTCAGTTGTGAGCTGATACCC -3'
(R):5'- CCTGAGCAGAGTTGTCATACTCAG -3'
Posted On2014-07-14