Incidental Mutation 'R1936:Cdc42bpg'
ID215856
Institutional Source Beutler Lab
Gene Symbol Cdc42bpg
Ensembl Gene ENSMUSG00000024769
Gene NameCDC42 binding protein kinase gamma (DMPK-like)
SynonymsMRCKgamma
MMRRC Submission 039954-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.336) question?
Stock #R1936 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6306456-6325652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6310309 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 175 (Y175C)
Ref Sequence ENSEMBL: ENSMUSP00000025681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025681]
Predicted Effect probably damaging
Transcript: ENSMUST00000025681
AA Change: Y175C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025681
Gene: ENSMUSG00000024769
AA Change: Y175C

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
S_TKc 71 337 1.63e-87 SMART
S_TK_X 338 400 7.85e-12 SMART
coiled coil region 444 551 N/A INTRINSIC
coiled coil region 630 675 N/A INTRINSIC
Pfam:DMPK_coil 743 801 4.6e-21 PFAM
low complexity region 861 873 N/A INTRINSIC
C1 878 926 1.78e-7 SMART
PH 947 1067 3.57e-10 SMART
Pfam:CNH 1096 1362 7.5e-56 PFAM
low complexity region 1401 1412 N/A INTRINSIC
low complexity region 1535 1551 N/A INTRINSIC
Meta Mutation Damage Score 0.7747 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 99% (98/99)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,917,080 Q226R possibly damaging Het
9930021J03Rik A G 19: 29,753,677 F712S possibly damaging Het
Abca13 G A 11: 9,293,595 M1819I probably benign Het
Abca4 G A 3: 122,052,923 V30M probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Cacna2d4 A G 6: 119,270,761 D341G possibly damaging Het
Ccdc129 G T 6: 55,897,681 L205F probably damaging Het
Cep170b G T 12: 112,735,738 D322Y probably damaging Het
Cflar T A 1: 58,752,625 Y362* probably null Het
Chml A T 1: 175,687,259 C365* probably null Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dennd1c G A 17: 57,073,889 probably benign Het
Dgkz A T 2: 91,937,978 M761K possibly damaging Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Epha8 T C 4: 136,940,243 D309G probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gimap3 A T 6: 48,765,749 F82L probably damaging Het
Gm4862 T C 3: 139,128,492 noncoding transcript Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr152 A G 19: 4,142,532 D24G probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
Hip1r T A 5: 123,996,071 M270K probably damaging Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Mark3 A G 12: 111,618,365 M132V probably damaging Het
Mast3 A G 8: 70,784,800 Y577H probably damaging Het
Med24 A T 11: 98,718,816 probably null Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1095 A G 2: 86,851,401 M99T probably benign Het
Olfr288 T A 15: 98,187,581 H72L probably benign Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr870 A G 9: 20,171,181 L130P probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pphln1 A G 15: 93,488,987 D234G possibly damaging Het
Prdm2 T C 4: 143,134,462 S753G probably benign Het
Prss32 A G 17: 23,856,050 R125G possibly damaging Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Psmd11 T C 11: 80,428,744 L20P probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Sdr9c7 A G 10: 127,903,634 K206R probably benign Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc1a2 A G 2: 102,777,605 N530D probably benign Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Smchd1 T C 17: 71,463,791 Y132C probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Speg C T 1: 75,431,408 T3249I possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tdrd6 A G 17: 43,626,467 L1230P probably damaging Het
Tesk2 A G 4: 116,741,824 Y43C probably benign Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmprss11f T A 5: 86,544,864 Q67L probably benign Het
Tnfrsf23 A G 7: 143,668,554 F174L probably benign Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trim25 A T 11: 89,004,750 T206S probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trpc4 T A 3: 54,279,890 M421K probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vmn2r94 G A 17: 18,244,292 R579* probably null Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp26 A G 9: 20,437,553 Y572H probably benign Het
Zfp292 A G 4: 34,807,452 V1864A probably benign Het
Zfp952 A T 17: 33,003,669 H374L possibly damaging Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Cdc42bpg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdc42bpg APN 19 6312205 splice site probably benign
IGL01415:Cdc42bpg APN 19 6310851 missense probably damaging 1.00
IGL01517:Cdc42bpg APN 19 6318437 missense probably damaging 1.00
IGL01585:Cdc42bpg APN 19 6320432 missense possibly damaging 0.93
IGL01743:Cdc42bpg APN 19 6309823 critical splice donor site probably null
IGL01930:Cdc42bpg APN 19 6311368 missense probably damaging 1.00
IGL02092:Cdc42bpg APN 19 6316826 splice site probably benign
IGL02355:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02362:Cdc42bpg APN 19 6310809 missense possibly damaging 0.93
IGL02498:Cdc42bpg APN 19 6322793 missense probably benign
IGL03004:Cdc42bpg APN 19 6311383 missense probably benign 0.38
IGL03037:Cdc42bpg APN 19 6311200 missense probably damaging 1.00
PIT1430001:Cdc42bpg UTSW 19 6322552 splice site probably null
R0304:Cdc42bpg UTSW 19 6317248 missense probably damaging 0.99
R0367:Cdc42bpg UTSW 19 6311395 missense probably damaging 1.00
R0412:Cdc42bpg UTSW 19 6313457 missense probably damaging 1.00
R0742:Cdc42bpg UTSW 19 6318575 critical splice donor site probably null
R1026:Cdc42bpg UTSW 19 6317187 missense probably damaging 1.00
R1056:Cdc42bpg UTSW 19 6314021 missense probably benign 0.10
R1065:Cdc42bpg UTSW 19 6322826 missense probably damaging 1.00
R1476:Cdc42bpg UTSW 19 6313782 missense probably damaging 0.99
R1854:Cdc42bpg UTSW 19 6320807 missense possibly damaging 0.67
R1962:Cdc42bpg UTSW 19 6306855 missense probably damaging 1.00
R2070:Cdc42bpg UTSW 19 6320488 missense probably damaging 1.00
R2167:Cdc42bpg UTSW 19 6317677 missense probably damaging 1.00
R3826:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R3829:Cdc42bpg UTSW 19 6317645 missense probably damaging 0.99
R4190:Cdc42bpg UTSW 19 6321681 missense probably damaging 1.00
R4249:Cdc42bpg UTSW 19 6315266 missense possibly damaging 0.65
R4499:Cdc42bpg UTSW 19 6320555 missense possibly damaging 0.69
R4731:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4732:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4733:Cdc42bpg UTSW 19 6311191 missense probably damaging 1.00
R4797:Cdc42bpg UTSW 19 6320447 missense probably damaging 1.00
R4831:Cdc42bpg UTSW 19 6311335 missense probably damaging 0.97
R4984:Cdc42bpg UTSW 19 6316223 missense possibly damaging 0.88
R5092:Cdc42bpg UTSW 19 6313220 missense probably benign 0.01
R5135:Cdc42bpg UTSW 19 6320618 missense probably damaging 1.00
R5183:Cdc42bpg UTSW 19 6321805 intron probably benign
R5208:Cdc42bpg UTSW 19 6321720 missense probably benign 0.01
R5240:Cdc42bpg UTSW 19 6315899 missense probably damaging 1.00
R5475:Cdc42bpg UTSW 19 6311071 missense probably damaging 0.99
R5703:Cdc42bpg UTSW 19 6322673 missense possibly damaging 0.87
R5876:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R6024:Cdc42bpg UTSW 19 6317496 missense probably damaging 1.00
R6266:Cdc42bpg UTSW 19 6311473 missense probably damaging 1.00
R6450:Cdc42bpg UTSW 19 6314488 splice site probably null
R6493:Cdc42bpg UTSW 19 6318455 missense probably damaging 0.96
R6983:Cdc42bpg UTSW 19 6321668 missense probably damaging 1.00
R7080:Cdc42bpg UTSW 19 6315189 missense probably damaging 0.97
R7125:Cdc42bpg UTSW 19 6322291 missense probably damaging 1.00
R7183:Cdc42bpg UTSW 19 6310797 missense probably damaging 1.00
R7317:Cdc42bpg UTSW 19 6314504 missense probably benign 0.11
R7426:Cdc42bpg UTSW 19 6318398 missense probably damaging 1.00
R7504:Cdc42bpg UTSW 19 6306784 missense possibly damaging 0.85
R7530:Cdc42bpg UTSW 19 6322275 missense probably benign 0.21
R7530:Cdc42bpg UTSW 19 6322276 missense probably benign 0.12
R7739:Cdc42bpg UTSW 19 6310815 missense probably damaging 1.00
R7903:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
R7986:Cdc42bpg UTSW 19 6313469 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6309746 missense probably damaging 1.00
Z1177:Cdc42bpg UTSW 19 6314522 missense possibly damaging 0.94
Z1177:Cdc42bpg UTSW 19 6314523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCTTGGCTTCTCAGAGC -3'
(R):5'- AGTCAGATGTCCCCTGAATGG -3'

Sequencing Primer
(F):5'- TGACTCTTGGCTCTACAC -3'
(R):5'- TGAATGGGTAACACATCACTCCTCTG -3'
Posted On2014-07-14