Incidental Mutation 'R1936:9930021J03Rik'
ID215857
Institutional Source Beutler Lab
Gene Symbol 9930021J03Rik
Ensembl Gene ENSMUSG00000046138
Gene NameRIKEN cDNA 9930021J03 gene
SynonymsGm9832
MMRRC Submission 039954-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1936 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location29714402-29805989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29753677 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 712 (F712S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059484
AA Change: F712S

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054060
Gene: ENSMUSG00000046138
AA Change: F712S

DomainStartEndE-ValueType
low complexity region 4 66 N/A INTRINSIC
BROMO 75 198 1.22e-3 SMART
low complexity region 225 235 N/A INTRINSIC
coiled coil region 248 289 N/A INTRINSIC
low complexity region 347 365 N/A INTRINSIC
low complexity region 495 508 N/A INTRINSIC
coiled coil region 673 705 N/A INTRINSIC
low complexity region 722 756 N/A INTRINSIC
coiled coil region 764 796 N/A INTRINSIC
low complexity region 1146 1160 N/A INTRINSIC
internal_repeat_1 1164 1293 9.57e-8 PROSPERO
low complexity region 1295 1304 N/A INTRINSIC
low complexity region 1386 1415 N/A INTRINSIC
low complexity region 1468 1483 N/A INTRINSIC
low complexity region 1602 1624 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1732 1745 N/A INTRINSIC
internal_repeat_1 1766 1910 9.57e-8 PROSPERO
low complexity region 1987 1993 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2053 2071 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000175726
AA Change: F589S
Predicted Effect probably benign
Transcript: ENSMUST00000175764
SMART Domains Protein: ENSMUSP00000135031
Gene: ENSMUSG00000046138

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 379 393 N/A INTRINSIC
internal_repeat_1 397 526 2.65e-5 PROSPERO
low complexity region 528 537 N/A INTRINSIC
low complexity region 619 648 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
low complexity region 835 857 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 965 978 N/A INTRINSIC
internal_repeat_1 999 1143 2.65e-5 PROSPERO
low complexity region 1220 1226 N/A INTRINSIC
low complexity region 1246 1260 N/A INTRINSIC
low complexity region 1286 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176773
Predicted Effect possibly damaging
Transcript: ENSMUST00000177155
AA Change: F645S

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135473
Gene: ENSMUSG00000046138
AA Change: F645S

DomainStartEndE-ValueType
low complexity region 4 66 N/A INTRINSIC
BROMO 75 198 1.22e-3 SMART
low complexity region 205 219 N/A INTRINSIC
low complexity region 280 298 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
coiled coil region 606 638 N/A INTRINSIC
low complexity region 655 689 N/A INTRINSIC
coiled coil region 697 729 N/A INTRINSIC
low complexity region 1079 1093 N/A INTRINSIC
internal_repeat_1 1097 1226 1.32e-7 PROSPERO
low complexity region 1228 1237 N/A INTRINSIC
low complexity region 1319 1348 N/A INTRINSIC
low complexity region 1401 1416 N/A INTRINSIC
low complexity region 1535 1557 N/A INTRINSIC
low complexity region 1580 1596 N/A INTRINSIC
low complexity region 1665 1678 N/A INTRINSIC
internal_repeat_1 1699 1843 1.32e-7 PROSPERO
low complexity region 1920 1926 N/A INTRINSIC
low complexity region 1946 1960 N/A INTRINSIC
low complexity region 1986 2004 N/A INTRINSIC
Meta Mutation Damage Score 0.1375 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 99% (98/99)
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A G 6: 91,917,080 Q226R possibly damaging Het
Abca13 G A 11: 9,293,595 M1819I probably benign Het
Abca4 G A 3: 122,052,923 V30M probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Cacna2d4 A G 6: 119,270,761 D341G possibly damaging Het
Ccdc129 G T 6: 55,897,681 L205F probably damaging Het
Cdc42bpg A G 19: 6,310,309 Y175C probably damaging Het
Cep170b G T 12: 112,735,738 D322Y probably damaging Het
Cflar T A 1: 58,752,625 Y362* probably null Het
Chml A T 1: 175,687,259 C365* probably null Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dennd1c G A 17: 57,073,889 probably benign Het
Dgkz A T 2: 91,937,978 M761K possibly damaging Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Epha8 T C 4: 136,940,243 D309G probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gimap3 A T 6: 48,765,749 F82L probably damaging Het
Gm4862 T C 3: 139,128,492 noncoding transcript Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr152 A G 19: 4,142,532 D24G probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
Hip1r T A 5: 123,996,071 M270K probably damaging Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Mark3 A G 12: 111,618,365 M132V probably damaging Het
Mast3 A G 8: 70,784,800 Y577H probably damaging Het
Med24 A T 11: 98,718,816 probably null Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1095 A G 2: 86,851,401 M99T probably benign Het
Olfr288 T A 15: 98,187,581 H72L probably benign Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr870 A G 9: 20,171,181 L130P probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pphln1 A G 15: 93,488,987 D234G possibly damaging Het
Prdm2 T C 4: 143,134,462 S753G probably benign Het
Prss32 A G 17: 23,856,050 R125G possibly damaging Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Psmd11 T C 11: 80,428,744 L20P probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Sdr9c7 A G 10: 127,903,634 K206R probably benign Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc1a2 A G 2: 102,777,605 N530D probably benign Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Smchd1 T C 17: 71,463,791 Y132C probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Speg C T 1: 75,431,408 T3249I possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Srsf6 C T 2: 162,934,483 probably benign Het
Tdrd6 A G 17: 43,626,467 L1230P probably damaging Het
Tesk2 A G 4: 116,741,824 Y43C probably benign Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmprss11f T A 5: 86,544,864 Q67L probably benign Het
Tnfrsf23 A G 7: 143,668,554 F174L probably benign Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trim25 A T 11: 89,004,750 T206S probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trpc4 T A 3: 54,279,890 M421K probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vmn2r94 G A 17: 18,244,292 R579* probably null Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zfp26 A G 9: 20,437,553 Y572H probably benign Het
Zfp292 A G 4: 34,807,452 V1864A probably benign Het
Zfp952 A T 17: 33,003,669 H374L possibly damaging Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in 9930021J03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:9930021J03Rik APN 19 29754020 missense probably benign 0.33
IGL01535:9930021J03Rik APN 19 29753812 missense possibly damaging 0.53
IGL02019:9930021J03Rik APN 19 29717063 missense probably benign 0.28
IGL02034:9930021J03Rik APN 19 29716859 missense possibly damaging 0.73
IGL03114:9930021J03Rik APN 19 29717132 missense probably benign 0.18
IGL03382:9930021J03Rik APN 19 29717276 missense probably damaging 1.00
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0020:9930021J03Rik UTSW 19 29716197 missense probably damaging 0.98
R0142:9930021J03Rik UTSW 19 29718254 missense possibly damaging 0.93
R0178:9930021J03Rik UTSW 19 29754788 missense probably damaging 1.00
R0453:9930021J03Rik UTSW 19 29753668 missense probably damaging 1.00
R0730:9930021J03Rik UTSW 19 29717981 missense probably benign 0.00
R0735:9930021J03Rik UTSW 19 29717638 missense possibly damaging 0.92
R0891:9930021J03Rik UTSW 19 29717653 missense probably damaging 1.00
R0894:9930021J03Rik UTSW 19 29720574 splice site probably benign
R1289:9930021J03Rik UTSW 19 29723452 missense probably benign 0.07
R1368:9930021J03Rik UTSW 19 29716396 missense probably damaging 0.97
R1387:9930021J03Rik UTSW 19 29723453 missense probably benign 0.15
R1483:9930021J03Rik UTSW 19 29719345 missense possibly damaging 0.93
R1526:9930021J03Rik UTSW 19 29735145 missense probably damaging 1.00
R1612:9930021J03Rik UTSW 19 29717845 missense possibly damaging 0.86
R1721:9930021J03Rik UTSW 19 29743598 missense probably damaging 0.99
R1764:9930021J03Rik UTSW 19 29719160 missense possibly damaging 0.53
R1822:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1824:9930021J03Rik UTSW 19 29716414 missense probably damaging 0.99
R1859:9930021J03Rik UTSW 19 29754923 missense possibly damaging 0.53
R1868:9930021J03Rik UTSW 19 29743598 missense probably damaging 0.99
R1880:9930021J03Rik UTSW 19 29718123 missense probably benign 0.06
R1898:9930021J03Rik UTSW 19 29735132 missense possibly damaging 0.74
R1939:9930021J03Rik UTSW 19 29753677 missense possibly damaging 0.87
R1969:9930021J03Rik UTSW 19 29716675 missense possibly damaging 0.95
R2153:9930021J03Rik UTSW 19 29716829 missense probably benign 0.01
R2366:9930021J03Rik UTSW 19 29753635 missense probably damaging 0.99
R2379:9930021J03Rik UTSW 19 29718875 missense probably benign 0.01
R3107:9930021J03Rik UTSW 19 29723447 missense probably damaging 1.00
R4012:9930021J03Rik UTSW 19 29743590 missense probably damaging 1.00
R4222:9930021J03Rik UTSW 19 29718749 missense probably benign 0.18
R4328:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4329:9930021J03Rik UTSW 19 29743561 missense probably benign 0.00
R4387:9930021J03Rik UTSW 19 29805315 unclassified probably benign
R4688:9930021J03Rik UTSW 19 29717101 missense probably benign 0.33
R4796:9930021J03Rik UTSW 19 29753618 missense probably benign 0.33
R4820:9930021J03Rik UTSW 19 29718409 missense possibly damaging 0.53
R4832:9930021J03Rik UTSW 19 29717216 missense possibly damaging 0.53
R5056:9930021J03Rik UTSW 19 29717359 missense probably benign
R5150:9930021J03Rik UTSW 19 29805550 missense probably damaging 0.96
R5224:9930021J03Rik UTSW 19 29719050 missense possibly damaging 0.73
R5306:9930021J03Rik UTSW 19 29729830 intron probably benign
R5460:9930021J03Rik UTSW 19 29754850 missense probably damaging 0.98
R5477:9930021J03Rik UTSW 19 29754118 missense probably benign 0.33
R5531:9930021J03Rik UTSW 19 29753672 missense possibly damaging 0.73
R5559:9930021J03Rik UTSW 19 29716963 missense possibly damaging 0.91
R5647:9930021J03Rik UTSW 19 29753810 missense possibly damaging 0.73
R5886:9930021J03Rik UTSW 19 29719277 missense probably benign 0.03
R6029:9930021J03Rik UTSW 19 29754967 unclassified probably benign
R6240:9930021J03Rik UTSW 19 29717240 missense probably benign 0.18
R6331:9930021J03Rik UTSW 19 29717747 missense probably benign 0.33
R6456:9930021J03Rik UTSW 19 29716514 missense possibly damaging 0.93
R6584:9930021J03Rik UTSW 19 29718728 missense possibly damaging 0.53
R6661:9930021J03Rik UTSW 19 29723464 missense possibly damaging 0.53
R6991:9930021J03Rik UTSW 19 29719108 missense possibly damaging 0.86
R7059:9930021J03Rik UTSW 19 29719545 missense probably benign 0.33
R7128:9930021J03Rik UTSW 19 29716481 missense possibly damaging 0.53
R7211:9930021J03Rik UTSW 19 29786312 missense
R7471:9930021J03Rik UTSW 19 29729739 intron probably null
R7686:9930021J03Rik UTSW 19 29717470 missense probably benign 0.34
R8012:9930021J03Rik UTSW 19 29718134 missense possibly damaging 0.73
RF011:9930021J03Rik UTSW 19 29743609 missense possibly damaging 0.53
X0027:9930021J03Rik UTSW 19 29735199 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGAAATAAAGCTTGACTCTCACAC -3'
(R):5'- CATTGATCATCCAGACATTAACTGC -3'

Sequencing Primer
(F):5'- GCTTGACTCTCACACACATAAG -3'
(R):5'- CATTAACTGCCACAAAGTTGTAAGGG -3'
Posted On2014-07-14