Mutagenetix > Incidental Mutation

Incidental Mutation 'R1935:Trip12'

215864

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

039953-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1935 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84794101 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 109 (S109G)

Ref Sequence

ENSEMBL: ENSMUSP00000140817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894] [ENSMUST00000187818] [ENSMUST00000189496] [ENSMUST00000190067]

AlphaFold

G5E870

Predicted Effect

probably benign
Transcript: ENSMUST00000027421
AA Change: S109G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: S109G

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185909
AA Change: S151G

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219
AA Change: S151G

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186465
AA Change: S109G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: S109G

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186648
AA Change: S109G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: S109G

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000186894
AA Change: S109G

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: S109G

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000187818

SMART Domains

Protein: ENSMUSP00000140917
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189496
AA Change: S151G

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000139682
Gene: ENSMUSG00000026219
AA Change: S151G

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190067
AA Change: S109G

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000140817
Gene: ENSMUSG00000026219
AA Change: S109G

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190464

Meta Mutation Damage Score

0.0609

Coding Region Coverage

1x: 97.3%
3x: 96.7%
10x: 94.9%
20x: 91.6%

Validation Efficiency

95% (95/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	G	A	3: 122,052,923	V30M	probably benign	Het
Abcg8	C	T	17: 84,694,989		probably benign	Het
Ablim1	T	A	19: 57,215,965		probably null	Het
Acvr1c	A	T	2: 58,283,505	N248K	probably damaging	Het
Adgrf3	A	T	5: 30,202,306	N207K	probably benign	Het
Anapc4	T	A	5: 52,839,668	D94E	probably damaging	Het
Arfgef2	A	G	2: 166,863,603	N918S	probably benign	Het
Arhgap45	A	G	10: 80,030,954	N1097S	probably damaging	Het
Atf2	G	A	2: 73,846,219	P184S	probably damaging	Het
Atg2a	A	G	19: 6,252,536	Y963C	probably damaging	Het
Atp8a2	T	C	14: 59,860,270	K770E	probably benign	Het
Atrn	T	C	2: 130,958,035	V444A	probably damaging	Het
Avpr1a	G	A	10: 122,449,790		probably null	Het
Best3	A	C	10: 117,024,386	Q517P	probably benign	Het
C3	A	G	17: 57,218,829	L851P	probably damaging	Het
Cacna2d2	T	C	9: 107,509,256	F194S	probably damaging	Het
Carns1	T	C	19: 4,165,474	E903G	probably damaging	Het
Chn1	A	G	2: 73,624,901	C39R	probably damaging	Het
Ciao1	A	G	2: 127,246,460	S148P	possibly damaging	Het
Clrn3	A	C	7: 135,514,024	I199S	possibly damaging	Het
Cngb1	C	A	8: 95,299,692	G154W	probably damaging	Het
Cnot2	G	C	10: 116,498,415	P274R	possibly damaging	Het
Cops7a	G	A	6: 124,962,396	R97*	probably null	Het
Coro7	T	C	16: 4,628,732	E843G	probably benign	Het
Crocc	T	C	4: 141,034,058	R755G	possibly damaging	Het
Crtam	G	C	9: 41,004,550	P13A	probably benign	Het
Ddrgk1	G	T	2: 130,663,560		probably benign	Het
Defb26	T	A	2: 152,508,275	K28N	possibly damaging	Het
Dnah8	A	G	17: 30,635,505	E47G	unknown	Het
Dnah8	G	A	17: 30,726,896		probably benign	Het
Dnhd1	A	T	7: 105,673,976	M564L	probably benign	Het
Dusp15	A	G	2: 152,945,421		probably benign	Het
Dync2h1	A	G	9: 7,139,159		probably null	Het
Eapp	A	T	12: 54,673,728	M234K	probably benign	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Gfi1b	T	C	2: 28,610,113	K302R	possibly damaging	Het
Gpatch1	A	G	7: 35,295,522	S440P	probably damaging	Het
Gpr6	T	C	10: 41,071,481	E35G	probably benign	Het
H2-Q1	A	T	17: 35,323,493	M305L	probably benign	Het
Hoxa10	C	A	6: 52,234,370	G189C	possibly damaging	Het
Kbtbd4	T	C	2: 90,907,551	V215A	probably damaging	Het
Klf16	G	A	10: 80,576,905	A99V	probably benign	Het
Lvrn	A	T	18: 46,878,320	Y448F	probably benign	Het
Med19	A	G	2: 84,685,658	H177R	possibly damaging	Het
Mif	G	T	10: 75,859,847	H41N	possibly damaging	Het
Mpl	A	G	4: 118,455,739	M132T	probably benign	Het
Mtcl1	G	T	17: 66,379,414	H480Q	probably benign	Het
Myo18b	T	C	5: 112,760,356	N2017S	probably benign	Het
Neurl4	C	T	11: 69,907,133	R740C	probably damaging	Het
Nlgn1	G	T	3: 26,331,790		probably benign	Het
Olfr1206	A	C	2: 88,865,180	M192L	probably benign	Het
Olfr128	T	A	17: 37,924,102	C179S	probably damaging	Het
Olfr319	T	A	11: 58,702,346	L215Q	probably damaging	Het
Olfr807	A	G	10: 129,754,715	V245A	probably damaging	Het
Paip1	T	A	13: 119,457,014	M463K	probably damaging	Het
Parp3	T	A	9: 106,474,732	Y147F	probably damaging	Het
Pgrmc2	C	A	3: 41,083,038		probably benign	Het
Phldb3	G	A	7: 24,617,407	A278T	probably benign	Het
Plxnb1	T	C	9: 109,095,647		probably null	Het
Pom121	G	A	5: 135,383,886	R481C	unknown	Het
Psg22	A	T	7: 18,719,710	N149I	probably damaging	Het
Recql5	T	C	11: 115,897,191	Y434C	probably benign	Het
Rexo1	A	G	10: 80,550,469	S252P	probably benign	Het
Rtl1	A	G	12: 109,591,920	S1162P	probably benign	Het
Samd9l	G	T	6: 3,376,269	Q331K	probably benign	Het
Sipa1l1	T	C	12: 82,372,434	Y629H	probably damaging	Het
Slc12a2	A	T	18: 57,904,353	I512L	possibly damaging	Het
Slc17a8	T	C	10: 89,577,915	M484V	probably benign	Het
Slc25a24	A	T	3: 109,136,265	E79D	probably damaging	Het
Snw1	T	A	12: 87,459,477	I218F	probably damaging	Het
Sorcs1	T	C	19: 50,232,644	D545G	probably damaging	Het
Sorcs2	A	G	5: 36,071,387	S104P	possibly damaging	Het
Spry4	A	G	18: 38,590,089	I207T	possibly damaging	Het
Tex101	A	G	7: 24,668,225	V234A	probably benign	Het
Thra	T	A	11: 98,763,073		probably benign	Het
Tmem161b	T	A	13: 84,293,466	L210Q	probably damaging	Het
Tmem50a	A	G	4: 134,903,642		probably benign	Het
Tmem63b	A	G	17: 45,678,961		probably null	Het
Tnrc6c	A	G	11: 117,756,023	D1450G	possibly damaging	Het
Trdmt1	A	G	2: 13,511,609	L386P	probably damaging	Het
Trit1	T	C	4: 123,054,240	I451T	probably benign	Het
Ttc34	G	A	4: 154,865,682	A1031T	possibly damaging	Het
Ttn	T	A	2: 76,747,178	D24457V	probably damaging	Het
Ttn	A	C	2: 76,885,490		probably benign	Het
Tubgcp4	A	T	2: 121,178,666		probably benign	Het
Ubiad1	A	G	4: 148,444,011	L147P	probably damaging	Het
Vps72	T	A	3: 95,122,540	V290D	probably benign	Het
Zfp408	A	T	2: 91,649,748	M1K	probably null	Het
Zfy2	C	A	Y: 2,121,496	M132I	probably benign	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7818:Trip12	UTSW	1	84760806	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGATCTCTCTTCGGCAC -3'
(R):5'- CTGTCATAGTTCCACAACCAGAG -3'

Sequencing Primer
(F):5'- ACCAGTTGATTCGGACCCAG -3'
(R):5'- GAGGATCCAGACAGAGCCAATACTTC -3'

Posted On

2014-07-14