Incidental Mutation 'R1935:Gfi1b'
ID215867
Institutional Source Beutler Lab
Gene Symbol Gfi1b
Ensembl Gene ENSMUSG00000026815
Gene Namegrowth factor independent 1B
SynonymsGfi-1B
MMRRC Submission 039953-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1935 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28609450-28621982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28610113 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 302 (K302R)
Ref Sequence ENSEMBL: ENSMUSP00000028156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028156] [ENSMUST00000164290]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028156
AA Change: K302R

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028156
Gene: ENSMUSG00000026815
AA Change: K302R

DomainStartEndE-ValueType
low complexity region 39 55 N/A INTRINSIC
ZnF_C2H2 163 186 2.95e-3 SMART
ZnF_C2H2 192 214 5.5e-3 SMART
ZnF_C2H2 220 242 4.79e-3 SMART
ZnF_C2H2 248 270 1.82e-3 SMART
ZnF_C2H2 276 298 1.47e-3 SMART
ZnF_C2H2 304 327 7.78e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155686
Predicted Effect possibly damaging
Transcript: ENSMUST00000164290
AA Change: K335R

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128052
Gene: ENSMUSG00000026815
AA Change: K335R

DomainStartEndE-ValueType
low complexity region 39 55 N/A INTRINSIC
ZnF_C2H2 163 186 2.95e-3 SMART
ZnF_C2H2 192 214 5.5e-3 SMART
low complexity region 231 244 N/A INTRINSIC
ZnF_C2H2 253 275 4.79e-3 SMART
ZnF_C2H2 281 303 1.82e-3 SMART
ZnF_C2H2 309 331 1.47e-3 SMART
ZnF_C2H2 337 360 7.78e-3 SMART
Meta Mutation Damage Score 0.2283 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger containing transcriptional regulator that is primarily expressed in cells of hematopoietic lineage. The encoded protein complexes with numerous other transcriptional regulatory proteins including GATA-1, runt-related transcription factor 1 and histone deacetylases to control expression of genes involved in the development and maturation of erythrocytes and megakaryocytes. Mutations in this gene are the cause of the autosomal dominant platelet disorder, platelet-type bleeding disorder-17. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruption of this gene die as embryos by day E15. Mature adult red blood cells and megakaryocytes fail to develop. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,052,923 V30M probably benign Het
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Med19 A G 2: 84,685,658 H177R possibly damaging Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Mtcl1 G T 17: 66,379,414 H480Q probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfp408 A T 2: 91,649,748 M1K probably null Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Gfi1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Gfi1b APN 2 28614785 nonsense probably null
IGL01595:Gfi1b APN 2 28611417 critical splice donor site probably null
R0196:Gfi1b UTSW 2 28613774 missense probably damaging 1.00
R0321:Gfi1b UTSW 2 28613885 missense probably damaging 0.98
R1078:Gfi1b UTSW 2 28613865 missense probably damaging 1.00
R1936:Gfi1b UTSW 2 28610113 missense possibly damaging 0.78
R2311:Gfi1b UTSW 2 28610174 missense probably damaging 1.00
R4646:Gfi1b UTSW 2 28610137 missense probably damaging 0.99
R4911:Gfi1b UTSW 2 28610102 missense probably damaging 1.00
R6031:Gfi1b UTSW 2 28613808 nonsense probably null
R6031:Gfi1b UTSW 2 28613808 nonsense probably null
R8029:Gfi1b UTSW 2 28613675 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTGGTTGAGGTCATCCAG -3'
(R):5'- ACCCAGTAGCGAATGTGTG -3'

Sequencing Primer
(F):5'- TGGTTGAGGTCATCCAGTCTCAAAAG -3'
(R):5'- CCAGTAGCGAATGTGTGACAGG -3'
Posted On2014-07-14