Incidental Mutation 'R1935:Med19'
ID215874
Institutional Source Beutler Lab
Gene Symbol Med19
Ensembl Gene ENSMUSG00000027080
Gene Namemediator complex subunit 19
SynonymsLCMR1, 3110040A13Rik, 2410018M14Rik
MMRRC Submission 039953-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R1935 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location84678402-84688215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84685658 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 177 (H177R)
Ref Sequence ENSEMBL: ENSMUSP00000099705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035840] [ENSMUST00000102645]
Predicted Effect probably benign
Transcript: ENSMUST00000035840
SMART Domains Protein: ENSMUSP00000048198
Gene: ENSMUSG00000034075

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
Pfam:zf-DHHC 99 224 1.6e-37 PFAM
low complexity region 312 318 N/A INTRINSIC
low complexity region 359 373 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
low complexity region 581 597 N/A INTRINSIC
low complexity region 679 695 N/A INTRINSIC
low complexity region 698 708 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102645
AA Change: H177R

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099705
Gene: ENSMUSG00000027080
AA Change: H177R

DomainStartEndE-ValueType
low complexity region 24 55 N/A INTRINSIC
Pfam:Med19 63 234 4e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141595
Meta Mutation Damage Score 0.0730 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the Mediator complex, which binds to gene-specific regulatory factors and provides support for the basal RNA polymerase II transcription machinery. This gene has been implicated in the growth of several types of cancer, and inhibition of its expression inhibits the growth and spread of these cancers. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,052,923 V30M probably benign Het
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Mtcl1 G T 17: 66,379,414 H480Q probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfp408 A T 2: 91,649,748 M1K probably null Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Med19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02148:Med19 APN 2 84685259 missense probably damaging 1.00
IGL02175:Med19 APN 2 84678663 critical splice donor site probably null
IGL02378:Med19 APN 2 84685281 missense probably damaging 1.00
R0965:Med19 UTSW 2 84678449 missense probably damaging 0.96
R2316:Med19 UTSW 2 84686243 missense probably benign 0.15
R7857:Med19 UTSW 2 84685625 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGCTGTCTGGTTTCCG -3'
(R):5'- AGTCACTACTTGCCCAAGAAATGTC -3'

Sequencing Primer
(F):5'- CTCTTTTTGGGGAGTAAGAAAGC -3'
(R):5'- TGCCCAAGAAATGTCATTAAATGAG -3'
Posted On2014-07-14