Incidental Mutation 'R1935:Zfp408'
ID215877
Institutional Source Beutler Lab
Gene Symbol Zfp408
Ensembl Gene ENSMUSG00000075040
Gene Namezinc finger protein 408
SynonymsLOC381410
MMRRC Submission 039953-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1935 (G1)
Quality Score209
Status Validated
Chromosome2
Chromosomal Location91643669-91649791 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 91649748 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000097301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090614] [ENSMUST00000099714] [ENSMUST00000111329] [ENSMUST00000111330] [ENSMUST00000111331] [ENSMUST00000111333] [ENSMUST00000145582]
Predicted Effect probably benign
Transcript: ENSMUST00000090614
SMART Domains Protein: ENSMUSP00000088105
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099714
AA Change: M1K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097301
Gene: ENSMUSG00000075040
AA Change: M1K

DomainStartEndE-ValueType
ZnF_C2H2 344 366 7.05e-1 SMART
ZnF_C2H2 372 394 1.67e-2 SMART
ZnF_C2H2 400 422 2.24e-3 SMART
ZnF_C2H2 428 450 8.6e-5 SMART
ZnF_C2H2 459 481 5.9e-3 SMART
ZnF_C2H2 487 509 4.87e-4 SMART
ZnF_C2H2 515 537 2.95e-3 SMART
ZnF_C2H2 542 564 2.2e-2 SMART
ZnF_C2H2 570 592 1.69e-3 SMART
ZnF_C2H2 598 620 3.89e-3 SMART
low complexity region 625 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111329
SMART Domains Protein: ENSMUSP00000106961
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111330
SMART Domains Protein: ENSMUSP00000106962
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111331
SMART Domains Protein: ENSMUSP00000106963
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 44 58 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
SEC14 104 255 5.08e-25 SMART
low complexity region 264 278 N/A INTRINSIC
RhoGAP 297 468 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111333
SMART Domains Protein: ENSMUSP00000106965
Gene: ENSMUSG00000075040

DomainStartEndE-ValueType
ZnF_C2H2 244 266 7.05e-1 SMART
ZnF_C2H2 272 294 1.67e-2 SMART
ZnF_C2H2 300 322 2.24e-3 SMART
ZnF_C2H2 328 350 8.6e-5 SMART
ZnF_C2H2 359 381 5.9e-3 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 437 2.95e-3 SMART
ZnF_C2H2 442 464 2.2e-2 SMART
ZnF_C2H2 470 492 1.69e-3 SMART
ZnF_C2H2 498 520 3.89e-3 SMART
low complexity region 525 538 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141012
Predicted Effect probably null
Transcript: ENSMUST00000145582
AA Change: M1K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155045
Meta Mutation Damage Score 0.9195 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten tandem zinc fingers and an N-terminal SET domain, so it is likely a DNA binding protein that interacts with other proteins. In adults, the encoded protein is expressed most highly in retina. Consequently, defects in this gene have been associated with familial exudative vitreoretinopathy (FEVR) and retinitis pigmentosa (RP). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,052,923 V30M probably benign Het
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Med19 A G 2: 84,685,658 H177R possibly damaging Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Mtcl1 G T 17: 66,379,414 H480Q probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Zfp408
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Zfp408 APN 2 91648006 splice site probably benign
IGL02374:Zfp408 APN 2 91645811 missense probably damaging 1.00
IGL03012:Zfp408 APN 2 91647808 missense probably benign
Innuendo UTSW 2 91646345 missense probably benign 0.06
Slander UTSW 2 91647849 splice site probably benign
R0467:Zfp408 UTSW 2 91645537 missense possibly damaging 0.86
R0981:Zfp408 UTSW 2 91645183 missense probably benign 0.38
R1579:Zfp408 UTSW 2 91646128 missense probably benign 0.05
R1673:Zfp408 UTSW 2 91646008 missense probably damaging 0.97
R2071:Zfp408 UTSW 2 91646018 missense probably damaging 0.96
R2127:Zfp408 UTSW 2 91645174 missense probably damaging 0.98
R2141:Zfp408 UTSW 2 91647849 splice site probably benign
R3688:Zfp408 UTSW 2 91646432 missense probably benign 0.00
R4681:Zfp408 UTSW 2 91645786 missense probably damaging 1.00
R4782:Zfp408 UTSW 2 91645024 missense possibly damaging 0.88
R4939:Zfp408 UTSW 2 91645105 missense probably damaging 1.00
R5306:Zfp408 UTSW 2 91646345 missense probably benign 0.06
R5344:Zfp408 UTSW 2 91645243 missense probably benign 0.15
R6054:Zfp408 UTSW 2 91649291 missense probably benign 0.00
R7985:Zfp408 UTSW 2 91646431 missense probably benign
R8193:Zfp408 UTSW 2 91645016 missense probably benign 0.00
Z1176:Zfp408 UTSW 2 91647805 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGGAGTCTAGTCTCTTAGGGC -3'
(R):5'- AACTAGCGGGCCTCTGAAATC -3'

Sequencing Primer
(F):5'- CACCGGAGCAGGATCCCAG -3'
(R):5'- GGGCCTCTGAAATCCTAGGTTC -3'
Posted On2014-07-14