Incidental Mutation 'R1935:Ciao1'
ID215879
Institutional Source Beutler Lab
Gene Symbol Ciao1
Ensembl Gene ENSMUSG00000003662
Gene Namecytosolic iron-sulfur protein assembly 1
SynonymsWdr39
MMRRC Submission 039953-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1935 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127240938-127247816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127246460 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 148 (S148P)
Ref Sequence ENSEMBL: ENSMUSP00000134159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003759] [ENSMUST00000035871] [ENSMUST00000172636] [ENSMUST00000174030] [ENSMUST00000174288] [ENSMUST00000174503] [ENSMUST00000174863]
Predicted Effect probably benign
Transcript: ENSMUST00000003759
AA Change: S148P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000003759
Gene: ENSMUSG00000003662
AA Change: S148P

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
WD40 240 280 8.04e-4 SMART
WD40 291 332 5.26e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035871
SMART Domains Protein: ENSMUSP00000035434
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 179 3e-98 BLAST
low complexity region 202 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143575
Predicted Effect probably benign
Transcript: ENSMUST00000172636
SMART Domains Protein: ENSMUSP00000134199
Gene: ENSMUSG00000003662

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174030
AA Change: S148P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134189
Gene: ENSMUSG00000003662
AA Change: S148P

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 178 6.04e-8 SMART
WD40 183 222 9.22e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174288
SMART Domains Protein: ENSMUSP00000134629
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
Blast:Sec63 1 95 1e-60 BLAST
low complexity region 118 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174503
SMART Domains Protein: ENSMUSP00000133701
Gene: ENSMUSG00000034850

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Blast:Sec63 37 124 8e-37 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000174863
AA Change: S148P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134159
Gene: ENSMUSG00000003662
AA Change: S148P

DomainStartEndE-ValueType
WD40 4 44 6.73e-6 SMART
WD40 49 89 4.27e-8 SMART
WD40 94 133 5.22e-12 SMART
WD40 139 176 1.38e1 SMART
Meta Mutation Damage Score 0.2814 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 95% (95/100)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 G A 3: 122,052,923 V30M probably benign Het
Abcg8 C T 17: 84,694,989 probably benign Het
Ablim1 T A 19: 57,215,965 probably null Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adgrf3 A T 5: 30,202,306 N207K probably benign Het
Anapc4 T A 5: 52,839,668 D94E probably damaging Het
Arfgef2 A G 2: 166,863,603 N918S probably benign Het
Arhgap45 A G 10: 80,030,954 N1097S probably damaging Het
Atf2 G A 2: 73,846,219 P184S probably damaging Het
Atg2a A G 19: 6,252,536 Y963C probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atrn T C 2: 130,958,035 V444A probably damaging Het
Avpr1a G A 10: 122,449,790 probably null Het
Best3 A C 10: 117,024,386 Q517P probably benign Het
C3 A G 17: 57,218,829 L851P probably damaging Het
Cacna2d2 T C 9: 107,509,256 F194S probably damaging Het
Carns1 T C 19: 4,165,474 E903G probably damaging Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Clrn3 A C 7: 135,514,024 I199S possibly damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Cnot2 G C 10: 116,498,415 P274R possibly damaging Het
Cops7a G A 6: 124,962,396 R97* probably null Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crocc T C 4: 141,034,058 R755G possibly damaging Het
Crtam G C 9: 41,004,550 P13A probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Defb26 T A 2: 152,508,275 K28N possibly damaging Het
Dnah8 A G 17: 30,635,505 E47G unknown Het
Dnah8 G A 17: 30,726,896 probably benign Het
Dnhd1 A T 7: 105,673,976 M564L probably benign Het
Dusp15 A G 2: 152,945,421 probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eapp A T 12: 54,673,728 M234K probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Gfi1b T C 2: 28,610,113 K302R possibly damaging Het
Gpatch1 A G 7: 35,295,522 S440P probably damaging Het
Gpr6 T C 10: 41,071,481 E35G probably benign Het
H2-Q1 A T 17: 35,323,493 M305L probably benign Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Kbtbd4 T C 2: 90,907,551 V215A probably damaging Het
Klf16 G A 10: 80,576,905 A99V probably benign Het
Lvrn A T 18: 46,878,320 Y448F probably benign Het
Med19 A G 2: 84,685,658 H177R possibly damaging Het
Mif G T 10: 75,859,847 H41N possibly damaging Het
Mpl A G 4: 118,455,739 M132T probably benign Het
Mtcl1 G T 17: 66,379,414 H480Q probably benign Het
Myo18b T C 5: 112,760,356 N2017S probably benign Het
Neurl4 C T 11: 69,907,133 R740C probably damaging Het
Nlgn1 G T 3: 26,331,790 probably benign Het
Olfr1206 A C 2: 88,865,180 M192L probably benign Het
Olfr128 T A 17: 37,924,102 C179S probably damaging Het
Olfr319 T A 11: 58,702,346 L215Q probably damaging Het
Olfr807 A G 10: 129,754,715 V245A probably damaging Het
Paip1 T A 13: 119,457,014 M463K probably damaging Het
Parp3 T A 9: 106,474,732 Y147F probably damaging Het
Pgrmc2 C A 3: 41,083,038 probably benign Het
Phldb3 G A 7: 24,617,407 A278T probably benign Het
Plxnb1 T C 9: 109,095,647 probably null Het
Pom121 G A 5: 135,383,886 R481C unknown Het
Psg22 A T 7: 18,719,710 N149I probably damaging Het
Recql5 T C 11: 115,897,191 Y434C probably benign Het
Rexo1 A G 10: 80,550,469 S252P probably benign Het
Rtl1 A G 12: 109,591,920 S1162P probably benign Het
Samd9l G T 6: 3,376,269 Q331K probably benign Het
Sipa1l1 T C 12: 82,372,434 Y629H probably damaging Het
Slc12a2 A T 18: 57,904,353 I512L possibly damaging Het
Slc17a8 T C 10: 89,577,915 M484V probably benign Het
Slc25a24 A T 3: 109,136,265 E79D probably damaging Het
Snw1 T A 12: 87,459,477 I218F probably damaging Het
Sorcs1 T C 19: 50,232,644 D545G probably damaging Het
Sorcs2 A G 5: 36,071,387 S104P possibly damaging Het
Spry4 A G 18: 38,590,089 I207T possibly damaging Het
Tex101 A G 7: 24,668,225 V234A probably benign Het
Thra T A 11: 98,763,073 probably benign Het
Tmem161b T A 13: 84,293,466 L210Q probably damaging Het
Tmem50a A G 4: 134,903,642 probably benign Het
Tmem63b A G 17: 45,678,961 probably null Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Trdmt1 A G 2: 13,511,609 L386P probably damaging Het
Trip12 T C 1: 84,794,101 S109G possibly damaging Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttn T A 2: 76,747,178 D24457V probably damaging Het
Ttn A C 2: 76,885,490 probably benign Het
Tubgcp4 A T 2: 121,178,666 probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Vps72 T A 3: 95,122,540 V290D probably benign Het
Zfp408 A T 2: 91,649,748 M1K probably null Het
Zfy2 C A Y: 2,121,496 M132I probably benign Het
Other mutations in Ciao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Ciao1 APN 2 127242835 missense probably benign
R1662:Ciao1 UTSW 2 127244937 missense probably benign 0.01
R1703:Ciao1 UTSW 2 127245819 missense probably benign 0.37
R1940:Ciao1 UTSW 2 127246460 missense possibly damaging 0.95
R2427:Ciao1 UTSW 2 127246691 missense probably damaging 1.00
R5891:Ciao1 UTSW 2 127247134 missense probably benign 0.08
R6295:Ciao1 UTSW 2 127246456 missense probably damaging 1.00
R6388:Ciao1 UTSW 2 127246476 nonsense probably null
R7211:Ciao1 UTSW 2 127247008 critical splice donor site probably null
R7448:Ciao1 UTSW 2 127245758 missense probably damaging 0.99
R7572:Ciao1 UTSW 2 127246711 nonsense probably null
R8145:Ciao1 UTSW 2 127245806 missense possibly damaging 0.90
R8245:Ciao1 UTSW 2 127246484 missense probably damaging 1.00
R8912:Ciao1 UTSW 2 127246679 missense not run
Predicted Primers PCR Primer
(F):5'- GTTCCCATATCAAACCCTGTCAG -3'
(R):5'- AGGTCAAGTCAGTGGCTTGG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGACAGTCC -3'
(R):5'- TCTTGGCTACCTGCAGCAGAG -3'
Posted On2014-07-14