Incidental Mutation 'R0129:Appl1'
ID21588
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms7330406P05Rik, 2900057D21Rik
MMRRC Submission 038414-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0129 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location26918988-26971232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26928643 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 524 (M524K)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
Predicted Effect probably damaging
Transcript: ENSMUST00000036570
AA Change: M524K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: M524K

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223843
Meta Mutation Damage Score 0.7366 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.7%
  • 10x: 92.2%
  • 20x: 74.4%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa2 A G 18: 74,787,194 D31G probably damaging Het
Actr2 A G 11: 20,100,939 probably benign Het
Adcy8 A G 15: 64,747,013 C764R probably benign Het
Ago4 A C 4: 126,517,183 F171C possibly damaging Het
Akt2 T C 7: 27,636,970 F408S probably damaging Het
Ankrd24 T C 10: 81,638,329 L26P probably damaging Het
Arhgef11 T A 3: 87,728,063 I922N probably damaging Het
Atp5h T C 11: 115,417,918 E47G probably damaging Het
Birc6 A G 17: 74,528,760 D70G probably benign Het
Bola2 G A 7: 126,696,559 V56M probably damaging Het
Ccdc151 G T 9: 21,993,552 R313S probably damaging Het
Cd300lg A G 11: 102,054,092 probably null Het
Cdc42bpb A G 12: 111,304,959 probably benign Het
Ceacam20 A G 7: 19,976,260 N403S probably damaging Het
Cenpf T C 1: 189,659,650 M662V probably benign Het
Chd3 C A 11: 69,348,501 E1607* probably null Het
Chtf18 A T 17: 25,727,311 Y9* probably null Het
Clta A G 4: 44,032,424 N200S probably benign Het
Csmd1 G A 8: 16,079,942 S1722F possibly damaging Het
Dennd4a T C 9: 64,893,294 S905P probably damaging Het
Dhx57 T C 17: 80,238,914 K1347R probably damaging Het
Dmc1 A T 15: 79,596,240 probably benign Het
Dnhd1 G T 7: 105,720,924 A4519S probably benign Het
Dnmbp A G 19: 43,850,027 C1120R probably benign Het
Efs C T 14: 54,917,223 A427T probably damaging Het
Erich6 T C 3: 58,624,378 E399G probably damaging Het
Espl1 A G 15: 102,316,648 T1431A probably benign Het
Fam184b A G 5: 45,532,778 S830P probably damaging Het
Fam49a C T 12: 12,362,349 T204I probably damaging Het
Herc1 T A 9: 66,448,075 C2203S probably damaging Het
Itpr1 G A 6: 108,349,676 V120M probably damaging Het
Kcnh7 G A 2: 62,716,159 T1026I probably benign Het
Kif1b A G 4: 149,261,201 I394T probably benign Het
Ldlrap1 A C 4: 134,757,422 V87G probably damaging Het
Lgals12 C T 19: 7,603,038 V155I probably damaging Het
Limch1 A T 5: 66,959,590 N116I probably damaging Het
Lonp2 C T 8: 86,634,890 R232C probably damaging Het
Lrch1 C A 14: 74,835,746 C151F probably benign Het
Lrig3 A G 10: 126,006,943 Y579C probably damaging Het
Macf1 T C 4: 123,433,275 S4808G probably damaging Het
Mapkap1 A T 2: 34,623,482 K501N probably damaging Het
Mdc1 G T 17: 35,854,445 R1523L probably benign Het
Mlh3 C T 12: 85,266,140 probably benign Het
Mul1 T C 4: 138,437,721 probably benign Het
Mybl2 G A 2: 163,059,491 probably benign Het
Notch1 G C 2: 26,460,458 H2223Q probably benign Het
Notch2 C A 3: 98,146,620 L2200M probably benign Het
Olfr1329 A T 4: 118,917,470 probably null Het
Olfr160 T C 9: 37,711,940 Y113C probably damaging Het
Olfr291 T A 7: 84,856,988 F206L probably benign Het
Olfr358 G A 2: 37,005,045 R190* probably null Het
Plekhs1 T C 19: 56,477,290 probably null Het
Ppm1h G A 10: 122,941,355 G509R probably damaging Het
Ppp2r3c C T 12: 55,298,422 E94K probably damaging Het
Ppp2r5e T A 12: 75,462,390 I372F probably damaging Het
Ptprt G A 2: 162,278,070 T159I probably benign Het
Rab20 A G 8: 11,454,415 F95S probably damaging Het
Rfc3 A C 5: 151,651,151 M1R probably null Het
Skp2 A G 15: 9,125,193 S100P probably damaging Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sspo A T 6: 48,455,418 T684S probably benign Het
Syt3 A G 7: 44,393,358 K355E probably damaging Het
Tcp10a A T 17: 7,343,504 K355N probably damaging Het
Tnrc18 A G 5: 142,765,045 probably benign Het
Tsfm A G 10: 127,030,470 L74P probably benign Het
Ttn G C 2: 76,734,265 N28509K probably damaging Het
Ube2l6 G A 2: 84,798,908 M1I probably null Het
Vmn2r80 T A 10: 79,169,496 H322Q probably damaging Het
Zkscan8 A T 13: 21,522,271 S212T probably benign Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0183:Appl1 UTSW 14 26962854 missense probably damaging 1.00
R0323:Appl1 UTSW 14 26942738 missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1856:Appl1 UTSW 14 26927749 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3722:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5536:Appl1 UTSW 14 26923780 nonsense probably null
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
R8110:Appl1 UTSW 14 26927794 nonsense probably null
R8129:Appl1 UTSW 14 26949509 missense possibly damaging 0.87
R8160:Appl1 UTSW 14 26928635 missense probably benign 0.35
R8211:Appl1 UTSW 14 26945598 missense probably benign 0.18
R8239:Appl1 UTSW 14 26964957 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCGTACCAGGATACATAGGACCAG -3'
(R):5'- AGTTAAGGCCAACCTGTGCTGC -3'

Sequencing Primer
(F):5'- AGAACTCACTGTGAGCCTTG -3'
(R):5'- CCAACCTGTGCTGCAAAAATAG -3'
Posted On2013-04-11